Incidental Mutation 'R5663:Olfr523'
ID444207
Institutional Source Beutler Lab
Gene Symbol Olfr523
Ensembl Gene ENSMUSG00000051051
Gene Nameolfactory receptor 523
SynonymsMOR104-4, GA_x6K02T2PBJ9-42327937-42328872
MMRRC Submission 043306-MU
Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140173217-140178758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140176321 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 67 (C67Y)
Ref Sequence ENSEMBL: ENSMUSP00000149562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
Predicted Effect probably damaging
Transcript: ENSMUST00000055890
AA Change: C73Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: C73Y

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209314
AA Change: C67Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213953
AA Change: C67Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214272
AA Change: C67Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215785
AA Change: C67Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216023
AA Change: C67Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Olfr523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr523 APN 7 140176615 missense probably damaging 1.00
IGL01759:Olfr523 APN 7 140176534 missense probably benign 0.00
D3080:Olfr523 UTSW 7 140176362 missense possibly damaging 0.94
R0503:Olfr523 UTSW 7 140176441 missense possibly damaging 0.95
R1644:Olfr523 UTSW 7 140176648 missense probably benign 0.12
R1760:Olfr523 UTSW 7 140176275 missense probably damaging 1.00
R1852:Olfr523 UTSW 7 140176561 nonsense probably null
R1960:Olfr523 UTSW 7 140176683 missense probably benign 0.37
R2363:Olfr523 UTSW 7 140176965 missense probably damaging 1.00
R3700:Olfr523 UTSW 7 140176214 missense possibly damaging 0.54
R4626:Olfr523 UTSW 7 140176446 missense probably damaging 1.00
R4678:Olfr523 UTSW 7 140176228 missense probably benign 0.21
R4779:Olfr523 UTSW 7 140176450 missense probably damaging 1.00
R4999:Olfr523 UTSW 7 140177020 missense probably damaging 1.00
R7352:Olfr523 UTSW 7 140176525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGTACTGGCCAGAACC -3'
(R):5'- TGTCATGATGCCACCGTAG -3'

Sequencing Primer
(F):5'- AGTACTGGCCAGAACCTGTCC -3'
(R):5'- CAGGTAGCGGTCATAAGCCATC -3'
Posted On2016-11-09