Incidental Mutation 'R5663:Rassf7'
ID444208
Institutional Source Beutler Lab
Gene Symbol Rassf7
Ensembl Gene ENSMUSG00000038618
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141215860-141218658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141217090 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 72 (T72I)
Ref Sequence ENSEMBL: ENSMUSP00000147482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000153081] [ENSMUST00000170841] [ENSMUST00000209500] [ENSMUST00000210993]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000046890
AA Change: T72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618
AA Change: T72I

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083617
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably damaging
Transcript: ENSMUST00000133763
AA Change: T72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618
AA Change: T72I

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141804
AA Change: T72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618
AA Change: T72I

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149548
Predicted Effect probably damaging
Transcript: ENSMUST00000153081
AA Change: T72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618
AA Change: T72I

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209500
AA Change: T72I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209760
Predicted Effect probably damaging
Transcript: ENSMUST00000210993
AA Change: T72I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Rassf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Rassf7 APN 7 141218290 missense possibly damaging 0.95
R0883:Rassf7 UTSW 7 141216990 splice site probably benign
R1275:Rassf7 UTSW 7 141217147 missense probably damaging 1.00
R1616:Rassf7 UTSW 7 141216732 missense probably damaging 1.00
R5546:Rassf7 UTSW 7 141217060 unclassified probably null
R5597:Rassf7 UTSW 7 141217111 missense probably damaging 1.00
R6250:Rassf7 UTSW 7 141217243 missense probably damaging 0.98
R6806:Rassf7 UTSW 7 141216809 missense probably damaging 1.00
R6817:Rassf7 UTSW 7 141217447 missense probably damaging 1.00
R6962:Rassf7 UTSW 7 141217590 missense possibly damaging 0.86
R7054:Rassf7 UTSW 7 141217643 missense probably benign 0.01
R7562:Rassf7 UTSW 7 141217188 nonsense probably null
R7682:Rassf7 UTSW 7 141217934 missense probably damaging 1.00
X0026:Rassf7 UTSW 7 141218132 nonsense probably null
Z1088:Rassf7 UTSW 7 141217145 missense probably damaging 1.00
Z1177:Rassf7 UTSW 7 141218285 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCATCTTCCCTTCCATGGAG -3'
(R):5'- CTGCAGGCTCAGGAATAGATG -3'

Sequencing Primer
(F):5'- CTTCCCTTCCATGGAGGGTGG -3'
(R):5'- ACCAGCTTGGGACATCTAAGGTTG -3'
Posted On2016-11-09