Incidental Mutation 'R5663:Fzr1'
ID444212
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Namefizzy and cell division cycle 20 related 1
SynonymsCdh1, Fyr
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81366222-81378516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81370526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 137 (S137P)
Ref Sequence ENSEMBL: ENSMUSP00000020457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020457
AA Change: S137P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235
AA Change: S137P

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect probably benign
Transcript: ENSMUST00000140901
AA Change: S137P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235
AA Change: S137P

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81370525 nonsense probably null
IGL02541:Fzr1 APN 10 81370033 missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81369184 missense probably benign 0.05
IGL03346:Fzr1 APN 10 81369184 missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81369394 nonsense probably null
R0179:Fzr1 UTSW 10 81369070 splice site probably benign
R0403:Fzr1 UTSW 10 81369368 missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81370367 missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81370319 missense probably damaging 0.98
R2358:Fzr1 UTSW 10 81367640 critical splice donor site probably null
R2844:Fzr1 UTSW 10 81369418 missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81367552 critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81371419 utr 5 prime probably benign
R5108:Fzr1 UTSW 10 81369450 splice site probably benign
R5201:Fzr1 UTSW 10 81367528 missense probably damaging 1.00
R5494:Fzr1 UTSW 10 81371344 critical splice donor site probably null
R5733:Fzr1 UTSW 10 81370326 missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81370826 critical splice acceptor site probably null
R6777:Fzr1 UTSW 10 81370493 missense probably damaging 1.00
R7055:Fzr1 UTSW 10 81370223 missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81368629 missense probably damaging 1.00
R7883:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
R8374:Fzr1 UTSW 10 81367534 missense probably damaging 1.00
R8428:Fzr1 UTSW 10 81371108 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTTGAAGGGAATCTTAGAGATC -3'
(R):5'- AGAGCACAAGGGGCTCTTTAC -3'

Sequencing Primer
(F):5'- AGGGAATCTTAGAGATCTTGCG -3'
(R):5'- CTCTTTACGGTGAGCCAGG -3'
Posted On2016-11-09