Incidental Mutation 'R5663:Arhgap44'
ID444214
Institutional Source Beutler Lab
Gene Symbol Arhgap44
Ensembl Gene ENSMUSG00000033389
Gene NameRho GTPase activating protein 44
SynonymsAU040829
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65002039-65162961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65024291 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 384 (F384I)
Ref Sequence ENSEMBL: ENSMUSP00000090681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000093002]
Predicted Effect probably damaging
Transcript: ENSMUST00000047463
AA Change: F384I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389
AA Change: F384I

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093002
AA Change: F384I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389
AA Change: F384I

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130420
AA Change: F258I
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389
AA Change: F258I

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Arhgap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgap44 APN 11 65041449 missense probably damaging 0.96
IGL01553:Arhgap44 APN 11 65053118 missense probably damaging 1.00
IGL01868:Arhgap44 APN 11 65012078 missense probably damaging 1.00
IGL01996:Arhgap44 APN 11 65005496 utr 3 prime probably benign
IGL02093:Arhgap44 APN 11 65074534 missense probably damaging 1.00
IGL02962:Arhgap44 APN 11 65067161 splice site probably benign
IGL02963:Arhgap44 APN 11 65031663 missense probably damaging 1.00
IGL03032:Arhgap44 APN 11 65024212 missense probably damaging 1.00
R0071:Arhgap44 UTSW 11 65011895 missense possibly damaging 0.90
R0152:Arhgap44 UTSW 11 65011919 missense probably benign 0.13
R0402:Arhgap44 UTSW 11 65032077 splice site probably benign
R1109:Arhgap44 UTSW 11 65026816 missense probably benign 0.00
R1694:Arhgap44 UTSW 11 65053197 missense probably damaging 1.00
R1946:Arhgap44 UTSW 11 65012096 missense probably damaging 0.99
R2036:Arhgap44 UTSW 11 65041492 missense possibly damaging 0.83
R2356:Arhgap44 UTSW 11 65010025 missense probably damaging 1.00
R4342:Arhgap44 UTSW 11 65012061 nonsense probably null
R4657:Arhgap44 UTSW 11 65005452 critical splice donor site probably null
R4763:Arhgap44 UTSW 11 65039165 missense probably damaging 0.98
R4803:Arhgap44 UTSW 11 65053095 missense probably benign 0.00
R5652:Arhgap44 UTSW 11 65024238 missense probably damaging 1.00
R5833:Arhgap44 UTSW 11 65038677 missense probably damaging 1.00
R6000:Arhgap44 UTSW 11 65032084 frame shift probably null
R6001:Arhgap44 UTSW 11 65032084 frame shift probably null
R6046:Arhgap44 UTSW 11 65032084 frame shift probably null
R6066:Arhgap44 UTSW 11 65032084 frame shift probably null
R6160:Arhgap44 UTSW 11 65162549 unclassified probably benign
R6661:Arhgap44 UTSW 11 65010008 missense probably damaging 0.97
R7062:Arhgap44 UTSW 11 65011932 missense probably benign 0.25
R7388:Arhgap44 UTSW 11 65024268 nonsense probably null
R7793:Arhgap44 UTSW 11 65009924 missense probably damaging 0.99
R8190:Arhgap44 UTSW 11 65038653 missense probably damaging 1.00
R8270:Arhgap44 UTSW 11 65022034 missense possibly damaging 0.58
R8321:Arhgap44 UTSW 11 65008227 missense probably benign 0.00
R8369:Arhgap44 UTSW 11 65059854 missense probably damaging 1.00
R8876:Arhgap44 UTSW 11 65008070 missense possibly damaging 0.93
X0022:Arhgap44 UTSW 11 65053212 missense probably damaging 1.00
X0061:Arhgap44 UTSW 11 65038645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGACTCAGGGCCCAGG -3'
(R):5'- TACCTGAGGCACAAGGACAG -3'

Sequencing Primer
(F):5'- AGGTCTCCTGCCCTACAG -3'
(R):5'- CACAAGGACAGATGGTTTCTTACTGG -3'
Posted On2016-11-09