Incidental Mutation 'R5663:Edil3'
ID444220
Institutional Source Beutler Lab
Gene Symbol Edil3
Ensembl Gene ENSMUSG00000034488
Gene NameEGF-like repeats and discoidin I-like domains 3
SynonymsDel-1, developmental endothelial locus-1, Del1
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location88821472-89323223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89042508 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 101 (I101M)
Ref Sequence ENSEMBL: ENSMUSP00000112829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043111] [ENSMUST00000081769] [ENSMUST00000118731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043111
AA Change: I91M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044652
Gene: ENSMUSG00000034488
AA Change: I91M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 67 107 1.62e-5 SMART
EGF_CA 109 145 4.32e-10 SMART
FA58C 147 304 3.7e-58 SMART
FA58C 308 466 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081769
AA Change: I101M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080462
Gene: ENSMUSG00000034488
AA Change: I101M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
FA58C 318 476 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118731
AA Change: I101M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112829
Gene: ENSMUSG00000034488
AA Change: I101M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
SCOP:d1d7pm_ 316 380 4e-20 SMART
Blast:FA58C 319 380 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153974
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no noticeable fur phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Edil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Edil3 APN 13 89289533 missense probably benign 0.40
IGL01628:Edil3 APN 13 89319826 utr 3 prime probably benign
IGL02112:Edil3 APN 13 89180255 missense probably damaging 1.00
IGL03123:Edil3 APN 13 89131736 missense probably damaging 1.00
R0402:Edil3 UTSW 13 89199451 splice site probably benign
R0608:Edil3 UTSW 13 89184849 missense probably damaging 1.00
R0675:Edil3 UTSW 13 89177280 missense probably damaging 0.96
R0735:Edil3 UTSW 13 89177178 missense probably damaging 0.97
R0991:Edil3 UTSW 13 89289506 nonsense probably null
R1507:Edil3 UTSW 13 89131712 missense probably damaging 1.00
R1643:Edil3 UTSW 13 89289576 critical splice donor site probably null
R2008:Edil3 UTSW 13 88944953 splice site probably null
R3703:Edil3 UTSW 13 89177298 missense probably benign 0.01
R4206:Edil3 UTSW 13 89180278 missense probably damaging 1.00
R4258:Edil3 UTSW 13 89177153 missense probably damaging 1.00
R4570:Edil3 UTSW 13 89131897 intron probably benign
R4575:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4576:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4654:Edil3 UTSW 13 89289470 missense probably damaging 1.00
R5420:Edil3 UTSW 13 89131772 missense probably damaging 1.00
R5446:Edil3 UTSW 13 89184838 missense possibly damaging 0.65
R5534:Edil3 UTSW 13 89199474 missense probably benign 0.00
R5653:Edil3 UTSW 13 89131812 missense probably damaging 1.00
R5664:Edil3 UTSW 13 89319713 missense probably damaging 1.00
R6179:Edil3 UTSW 13 88821989 missense probably benign
R6254:Edil3 UTSW 13 89319729 missense probably damaging 1.00
R6813:Edil3 UTSW 13 89289456 missense probably damaging 1.00
R7138:Edil3 UTSW 13 89131728 missense probably damaging 1.00
R7215:Edil3 UTSW 13 88822050 critical splice donor site probably null
R7295:Edil3 UTSW 13 89131783 nonsense probably null
Z1176:Edil3 UTSW 13 88944870 missense probably benign 0.19
Z1177:Edil3 UTSW 13 88822012 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCTCAAATCTCAAGCTCAAAGTTG -3'
(R):5'- ATCAGCATGGGGACTGGAAC -3'

Sequencing Primer
(F):5'- CTCAAGCTCAAAGTTGTCAGG -3'
(R):5'- GGTCTTATGAGCCAAAATGCC -3'
Posted On2016-11-09