Incidental Mutation 'R5663:Mroh6'
ID444223
Institutional Source Beutler Lab
Gene Symbol Mroh6
Ensembl Gene ENSMUSG00000098678
Gene Namemaestro heat-like repeat family member 6
SynonymsGm19570
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75884137-75888770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75888588 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000139029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023237] [ENSMUST00000184858] [ENSMUST00000229571]
Predicted Effect probably benign
Transcript: ENSMUST00000023237
SMART Domains Protein: ENSMUSP00000023237
Gene: ENSMUSG00000022574

DomainStartEndE-ValueType
PDB:4MZY|A 16 522 2e-70 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184858
AA Change: S46P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139029
Gene: ENSMUSG00000098678
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
SCOP:d1qbkb_ 366 704 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230739
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Mroh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2484:Mroh6 UTSW 15 75884328 missense probably benign 0.00
R5237:Mroh6 UTSW 15 75885991 missense possibly damaging 0.62
R5269:Mroh6 UTSW 15 75885790 missense probably damaging 0.99
R5274:Mroh6 UTSW 15 75885000 missense possibly damaging 0.90
R5961:Mroh6 UTSW 15 75887768 nonsense probably null
R6146:Mroh6 UTSW 15 75886637 missense possibly damaging 0.88
R6276:Mroh6 UTSW 15 75885700 missense probably damaging 0.99
R6731:Mroh6 UTSW 15 75888492 missense probably benign 0.00
R7779:Mroh6 UTSW 15 75888656 missense possibly damaging 0.85
R7790:Mroh6 UTSW 15 75884240 missense probably benign
R8725:Mroh6 UTSW 15 75884714 missense possibly damaging 0.94
Z1177:Mroh6 UTSW 15 75887818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACAGCCAAACTTTGC -3'
(R):5'- GGTCTGGACACAACTTCACTGG -3'

Sequencing Primer
(F):5'- AAACTTTGCATCATCCAGCATCTG -3'
(R):5'- CTGGAAGAGTGGTGGCAGGTG -3'
Posted On2016-11-09