Incidental Mutation 'R5663:Rfx3'
ID444227
Institutional Source Beutler Lab
Gene Symbol Rfx3
Ensembl Gene ENSMUSG00000040929
Gene Nameregulatory factor X, 3 (influences HLA class II expression)
SynonymsC230093O12Rik, MRFX3
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27761721-28011166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27793617 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 603 (F603S)
Ref Sequence ENSEMBL: ENSMUSP00000133461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174850]
Predicted Effect probably damaging
Transcript: ENSMUST00000046898
AA Change: F578S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: F578S

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 6.3e-58 PFAM
Pfam:RFX_DNA_binding 150 235 6.9e-41 PFAM
low complexity region 274 283 N/A INTRINSIC
internal_repeat_1 326 414 1.39e-5 PROSPERO
internal_repeat_1 439 527 1.39e-5 PROSPERO
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165566
AA Change: F603S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: F603S

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 138 9.7e-38 PFAM
Pfam:RFX_DNA_binding 181 258 6.2e-36 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172498
Predicted Effect probably damaging
Transcript: ENSMUST00000172907
AA Change: F603S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: F603S

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173863
SMART Domains Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 3.3e-58 PFAM
Pfam:RFX_DNA_binding 175 246 3.7e-24 PFAM
low complexity region 285 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174850
AA Change: F603S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: F603S

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Rfx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Rfx3 APN 19 27806186 critical splice donor site probably null
IGL00588:Rfx3 APN 19 27826076 nonsense probably null
IGL01408:Rfx3 APN 19 27768650 missense probably benign 0.04
IGL01937:Rfx3 APN 19 27830729 missense probably damaging 1.00
IGL02668:Rfx3 APN 19 27815614 splice site probably benign
IGL02679:Rfx3 APN 19 27849737 missense possibly damaging 0.95
R0267:Rfx3 UTSW 19 27793788 missense probably benign 0.00
R0336:Rfx3 UTSW 19 27806262 missense probably benign 0.00
R0838:Rfx3 UTSW 19 27849967 missense possibly damaging 0.92
R0967:Rfx3 UTSW 19 27806351 splice site probably benign
R1102:Rfx3 UTSW 19 27867600 missense possibly damaging 0.51
R1507:Rfx3 UTSW 19 27768513 missense probably benign 0.00
R2172:Rfx3 UTSW 19 27815494 nonsense probably null
R2844:Rfx3 UTSW 19 27806786 splice site probably benign
R2960:Rfx3 UTSW 19 27900811 nonsense probably null
R4291:Rfx3 UTSW 19 27800232 missense probably damaging 1.00
R4952:Rfx3 UTSW 19 27830672 missense probably damaging 1.00
R5198:Rfx3 UTSW 19 27830776 missense probably damaging 1.00
R5451:Rfx3 UTSW 19 27849959 missense probably damaging 1.00
R5590:Rfx3 UTSW 19 27802380 critical splice donor site probably null
R5641:Rfx3 UTSW 19 27793608 splice site probably null
R5899:Rfx3 UTSW 19 27830765 missense probably damaging 1.00
R6049:Rfx3 UTSW 19 27802395 missense probably damaging 0.99
R6368:Rfx3 UTSW 19 27768609 missense possibly damaging 0.92
R7131:Rfx3 UTSW 19 27768628 nonsense probably null
R7273:Rfx3 UTSW 19 27802458 missense probably damaging 1.00
R7593:Rfx3 UTSW 19 27849739 missense probably benign 0.00
R7814:Rfx3 UTSW 19 27826070 missense probably benign 0.01
R7815:Rfx3 UTSW 19 27826048 missense probably benign 0.00
Z1088:Rfx3 UTSW 19 27837450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATAACTCGCGGAAAACTTC -3'
(R):5'- AGTGTGATGACAACATGGTTCAG -3'

Sequencing Primer
(F):5'- CGCGGAAAACTTCTCAGCTTTGAG -3'
(R):5'- TGGTTCAGAGACTAGAAACAGACTTC -3'
Posted On2016-11-09