Incidental Mutation 'R5664:Qser1'
ID 444235
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Name glutamine and serine rich 1
Synonyms 4732486I23Rik
MMRRC Submission 043307-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.691) question?
Stock # R5664 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104754795-104816760 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104778196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 1444 (L1444I)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
AlphaFold A0A338P6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000117237
AA Change: L1354I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: L1354I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: L1444I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 (GRCm38) probably null Het
1810032O08Rik A T 11: 116,672,664 (GRCm38) T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 (GRCm38) I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 (GRCm38) L112H probably damaging Het
Acaca T C 11: 84,243,384 (GRCm38) L441P probably damaging Het
Ank3 G A 10: 70,002,565 (GRCm38) R1566K possibly damaging Het
Arsj A T 3: 126,438,657 (GRCm38) I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 (GRCm38) T373A probably damaging Het
Atr C A 9: 95,905,813 (GRCm38) N1486K probably benign Het
Avl9 T C 6: 56,753,839 (GRCm38) S583P probably damaging Het
Bptf A T 11: 107,073,699 (GRCm38) D1493E probably benign Het
C2cd2l T C 9: 44,313,772 (GRCm38) E548G probably damaging Het
Capn3 G A 2: 120,477,025 (GRCm38) R15Q probably benign Het
Ccl3 A G 11: 83,649,213 (GRCm38) F22S probably benign Het
Clcf1 T C 19: 4,222,096 (GRCm38) F69S probably damaging Het
Col13a1 T C 10: 61,851,116 (GRCm38) E170G probably damaging Het
Dhx29 T A 13: 112,946,879 (GRCm38) F489L probably damaging Het
Dhx8 A T 11: 101,740,751 (GRCm38) N390I probably damaging Het
Dkk1 T A 19: 30,548,789 (GRCm38) Y135F probably benign Het
Edil3 G T 13: 89,319,713 (GRCm38) V446F probably damaging Het
Epha5 T A 5: 84,331,866 (GRCm38) E93V probably damaging Het
Epsti1 C T 14: 77,963,664 (GRCm38) T196I possibly damaging Het
Fras1 T C 5: 96,728,535 (GRCm38) S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 (GRCm38) V1532A probably benign Het
Fsip2 T A 2: 82,988,095 (GRCm38) M4724K probably benign Het
Gcat T A 15: 79,043,073 (GRCm38) L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 (GRCm38) K276E probably benign Het
Gjb5 T A 4: 127,355,929 (GRCm38) I141F probably benign Het
Glt6d1 T C 2: 25,814,180 (GRCm38) I7V probably benign Het
Gm37596 A G 3: 93,692,687 (GRCm38) F125S probably benign Het
Gm5771 C T 6: 41,394,671 (GRCm38) P17L probably benign Het
Gm6169 C A 13: 97,099,121 (GRCm38) L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 (GRCm38) G30R probably damaging Het
Herc6 C A 6: 57,618,684 (GRCm38) T449K probably benign Het
Hpn A T 7: 31,099,262 (GRCm38) Y132N probably damaging Het
Hpx A T 7: 105,595,148 (GRCm38) M190K probably benign Het
Inf2 A G 12: 112,611,728 (GRCm38) H1151R unknown Het
Krt74 A G 15: 101,760,579 (GRCm38) noncoding transcript Het
Loxl3 G A 6: 83,049,882 (GRCm38) S564N probably benign Het
Map7 T A 10: 20,267,359 (GRCm38) V418E unknown Het
Mrpl37 T C 4: 107,064,391 (GRCm38) N214D probably benign Het
Mthfr T C 4: 148,055,466 (GRCm38) Y656H probably damaging Het
Myo9b A G 8: 71,359,882 (GRCm38) D2099G probably benign Het
Nktr T A 9: 121,749,417 (GRCm38) C825* probably null Het
Nomo1 A G 7: 46,076,157 (GRCm38) E1029G probably benign Het
Nup133 T C 8: 123,906,281 (GRCm38) D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 (GRCm38) F272L probably damaging Het
Olfr153 T C 2: 87,532,834 (GRCm38) L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 (GRCm38) V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 (GRCm38) L38P probably damaging Het
Pkd1 A T 17: 24,569,371 (GRCm38) D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 (GRCm38) T1070A probably damaging Het
Ppl T C 16: 5,106,055 (GRCm38) D185G probably benign Het
Prune1 A T 3: 95,258,178 (GRCm38) L261Q probably damaging Het
Serpina6 A C 12: 103,654,467 (GRCm38) C8G probably damaging Het
Sla2 A T 2: 156,874,999 (GRCm38) D180E probably benign Het
Slc4a4 C T 5: 89,028,244 (GRCm38) L25F probably damaging Het
Tbx3 A G 5: 119,678,731 (GRCm38) K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 (GRCm38) C167S probably damaging Het
Trak1 T A 9: 121,472,307 (GRCm38) C710S possibly damaging Het
Tsks G A 7: 44,953,784 (GRCm38) E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 (GRCm38) I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 (GRCm38) I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 (GRCm38) T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 (GRCm38) M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 (GRCm38) probably null Het
Wap A G 11: 6,638,609 (GRCm38) I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 (GRCm38) H665P probably damaging Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104,766,056 (GRCm38) missense probably damaging 1.00
IGL00402:Qser1 APN 2 104,786,981 (GRCm38) missense probably benign 0.00
IGL00417:Qser1 APN 2 104,786,903 (GRCm38) missense probably damaging 1.00
IGL00756:Qser1 APN 2 104,787,671 (GRCm38) missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104,787,631 (GRCm38) missense probably damaging 0.99
IGL01317:Qser1 APN 2 104,786,979 (GRCm38) missense probably damaging 0.99
IGL02186:Qser1 APN 2 104,788,261 (GRCm38) missense probably damaging 1.00
IGL03236:Qser1 APN 2 104,786,532 (GRCm38) missense probably benign 0.35
IGL03365:Qser1 APN 2 104,786,999 (GRCm38) missense probably damaging 1.00
Behoove UTSW 2 104,786,977 (GRCm38) nonsense probably null
I1329:Qser1 UTSW 2 104,786,977 (GRCm38) nonsense probably null
R0270:Qser1 UTSW 2 104,788,961 (GRCm38) missense probably benign 0.03
R0395:Qser1 UTSW 2 104,762,881 (GRCm38) missense probably damaging 1.00
R0523:Qser1 UTSW 2 104,789,676 (GRCm38) missense probably damaging 1.00
R0727:Qser1 UTSW 2 104,777,311 (GRCm38) splice site probably benign
R1037:Qser1 UTSW 2 104,760,555 (GRCm38) missense probably damaging 0.99
R1222:Qser1 UTSW 2 104,777,431 (GRCm38) missense probably damaging 1.00
R1418:Qser1 UTSW 2 104,777,431 (GRCm38) missense probably damaging 1.00
R1891:Qser1 UTSW 2 104,790,099 (GRCm38) missense probably benign
R1974:Qser1 UTSW 2 104,760,541 (GRCm38) missense probably damaging 1.00
R2200:Qser1 UTSW 2 104,789,013 (GRCm38) missense probably damaging 1.00
R4179:Qser1 UTSW 2 104,776,384 (GRCm38) missense probably benign 0.19
R4379:Qser1 UTSW 2 104,766,059 (GRCm38) splice site probably null
R4418:Qser1 UTSW 2 104,789,421 (GRCm38) missense probably damaging 1.00
R4585:Qser1 UTSW 2 104,786,793 (GRCm38) missense probably benign 0.01
R4697:Qser1 UTSW 2 104,787,183 (GRCm38) missense probably benign 0.00
R4749:Qser1 UTSW 2 104,787,304 (GRCm38) missense probably benign 0.16
R4775:Qser1 UTSW 2 104,789,901 (GRCm38) missense probably damaging 1.00
R5010:Qser1 UTSW 2 104,787,831 (GRCm38) missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104,787,282 (GRCm38) missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104,787,431 (GRCm38) missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104,786,642 (GRCm38) missense probably damaging 1.00
R5400:Qser1 UTSW 2 104,789,874 (GRCm38) missense probably damaging 1.00
R5502:Qser1 UTSW 2 104,786,574 (GRCm38) missense probably benign 0.00
R5615:Qser1 UTSW 2 104,789,694 (GRCm38) missense possibly damaging 0.78
R5750:Qser1 UTSW 2 104,788,923 (GRCm38) missense probably damaging 1.00
R5793:Qser1 UTSW 2 104,762,860 (GRCm38) missense probably damaging 1.00
R6035:Qser1 UTSW 2 104,787,123 (GRCm38) missense probably damaging 0.99
R6035:Qser1 UTSW 2 104,787,123 (GRCm38) missense probably damaging 0.99
R6171:Qser1 UTSW 2 104,789,283 (GRCm38) missense probably damaging 1.00
R6223:Qser1 UTSW 2 104,787,648 (GRCm38) missense probably benign 0.01
R6254:Qser1 UTSW 2 104,790,090 (GRCm38) missense probably benign 0.07
R6303:Qser1 UTSW 2 104,762,830 (GRCm38) missense probably damaging 1.00
R6653:Qser1 UTSW 2 104,780,260 (GRCm38) missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104,777,325 (GRCm38) missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104,788,130 (GRCm38) missense probably benign 0.25
R7064:Qser1 UTSW 2 104,787,119 (GRCm38) missense probably damaging 1.00
R7478:Qser1 UTSW 2 104,789,514 (GRCm38) missense probably damaging 1.00
R7643:Qser1 UTSW 2 104,786,977 (GRCm38) nonsense probably null
R7769:Qser1 UTSW 2 104,758,576 (GRCm38) missense possibly damaging 0.65
R7836:Qser1 UTSW 2 104,776,234 (GRCm38) missense probably damaging 1.00
R7938:Qser1 UTSW 2 104,788,967 (GRCm38) missense probably damaging 1.00
R8209:Qser1 UTSW 2 104,788,725 (GRCm38) missense probably benign 0.02
R8218:Qser1 UTSW 2 104,762,923 (GRCm38) missense probably damaging 1.00
R8226:Qser1 UTSW 2 104,788,725 (GRCm38) missense probably benign 0.02
R8341:Qser1 UTSW 2 104,789,475 (GRCm38) missense probably damaging 0.99
R8362:Qser1 UTSW 2 104,789,901 (GRCm38) missense probably damaging 1.00
R8785:Qser1 UTSW 2 104,787,753 (GRCm38) missense probably damaging 0.99
R8983:Qser1 UTSW 2 104,787,357 (GRCm38) missense probably benign 0.02
R9051:Qser1 UTSW 2 104,762,947 (GRCm38) missense possibly damaging 0.52
R9165:Qser1 UTSW 2 104,788,470 (GRCm38) missense probably benign 0.41
R9289:Qser1 UTSW 2 104,787,248 (GRCm38) missense possibly damaging 0.48
R9342:Qser1 UTSW 2 104,787,819 (GRCm38) missense probably benign 0.00
R9380:Qser1 UTSW 2 104,789,346 (GRCm38) nonsense probably null
R9736:Qser1 UTSW 2 104,789,643 (GRCm38) missense probably benign 0.00
T0722:Qser1 UTSW 2 104,786,832 (GRCm38) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGAGTGAGAGCTGGTACCTG -3'
(R):5'- GCGAGGTACTGCAGAAACTC -3'

Sequencing Primer
(F):5'- TAGGATCCCTAGAGCTGGAGCTATC -3'
(R):5'- GGTAAAGTCAGCCTGATCTACATGC -3'
Posted On 2016-11-09