Incidental Mutation 'R5664:Qser1'
ID 444235
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Name glutamine and serine rich 1
Synonyms 4732486I23Rik
MMRRC Submission 043307-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R5664 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104754795-104816760 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104778196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 1444 (L1444I)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
AlphaFold A0A338P6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000117237
AA Change: L1354I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: L1354I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: L1444I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
Behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1037:Qser1 UTSW 2 104760555 missense probably damaging 0.99
R1222:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R2200:Qser1 UTSW 2 104789013 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4379:Qser1 UTSW 2 104766059 splice site probably null
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6303:Qser1 UTSW 2 104762830 missense probably damaging 1.00
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
R7064:Qser1 UTSW 2 104787119 missense probably damaging 1.00
R7478:Qser1 UTSW 2 104789514 missense probably damaging 1.00
R7643:Qser1 UTSW 2 104786977 nonsense probably null
R7769:Qser1 UTSW 2 104758576 missense possibly damaging 0.65
R7836:Qser1 UTSW 2 104776234 missense probably damaging 1.00
R7938:Qser1 UTSW 2 104788967 missense probably damaging 1.00
R8209:Qser1 UTSW 2 104788725 missense probably benign 0.02
R8218:Qser1 UTSW 2 104762923 missense probably damaging 1.00
R8226:Qser1 UTSW 2 104788725 missense probably benign 0.02
R8341:Qser1 UTSW 2 104789475 missense probably damaging 0.99
R8362:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R8785:Qser1 UTSW 2 104787753 missense probably damaging 0.99
R8983:Qser1 UTSW 2 104787357 missense probably benign 0.02
R9051:Qser1 UTSW 2 104762947 missense possibly damaging 0.52
R9165:Qser1 UTSW 2 104788470 missense probably benign 0.41
R9289:Qser1 UTSW 2 104787248 missense possibly damaging 0.48
R9342:Qser1 UTSW 2 104787819 missense probably benign 0.00
R9380:Qser1 UTSW 2 104789346 nonsense probably null
R9736:Qser1 UTSW 2 104789643 missense probably benign 0.00
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGAGTGAGAGCTGGTACCTG -3'
(R):5'- GCGAGGTACTGCAGAAACTC -3'

Sequencing Primer
(F):5'- TAGGATCCCTAGAGCTGGAGCTATC -3'
(R):5'- GGTAAAGTCAGCCTGATCTACATGC -3'
Posted On 2016-11-09