Incidental Mutation 'H8786:Sqor'
ID44425
Institutional Source Beutler Lab
Gene Symbol Sqor
Ensembl Gene ENSMUSG00000005803
Gene Namesulfide quinone oxidoreductase
Synonyms0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score210
Status Not validated
Chromosome2
Chromosomal Location122765237-122809569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122792368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 142 (I142L)
Ref Sequence ENSEMBL: ENSMUSP00000117575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403]
Predicted Effect probably benign
Transcript: ENSMUST00000005953
AA Change: I142L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: I142L

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 44 189 1.7e-11 PFAM
SCOP:d1fcda1 240 364 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110506
AA Change: I142L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: I142L

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 342 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126403
AA Change: I142L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803
AA Change: I142L

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 192 8.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176999
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Sqor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Sqor APN 2 122787543 missense probably damaging 0.97
IGL01544:Sqor APN 2 122792346 splice site probably benign
IGL02499:Sqor APN 2 122808087 missense possibly damaging 0.93
IGL02583:Sqor APN 2 122799770 missense probably damaging 0.98
IGL02732:Sqor APN 2 122799762 missense possibly damaging 0.76
IGL03137:Sqor APN 2 122808071 missense probably benign
R0126:Sqor UTSW 2 122798027 unclassified probably benign
R0410:Sqor UTSW 2 122787522 missense probably benign
R0502:Sqor UTSW 2 122798050 missense probably benign 0.04
R0709:Sqor UTSW 2 122799855 missense probably benign 0.38
R1486:Sqor UTSW 2 122807645 splice site probably null
R2001:Sqor UTSW 2 122798098 missense probably damaging 0.98
R2020:Sqor UTSW 2 122804107 critical splice donor site probably null
R2039:Sqor UTSW 2 122792404 critical splice donor site probably null
R2404:Sqor UTSW 2 122808023 missense probably benign
R4213:Sqor UTSW 2 122787498 missense probably damaging 1.00
R4909:Sqor UTSW 2 122785181 missense possibly damaging 0.82
R5630:Sqor UTSW 2 122809357 missense possibly damaging 0.71
R5659:Sqor UTSW 2 122787603 missense probably benign 0.02
R5728:Sqor UTSW 2 122809400 makesense probably null
R5772:Sqor UTSW 2 122809341 missense probably benign 0.00
R6527:Sqor UTSW 2 122809286 missense probably damaging 0.98
R6657:Sqor UTSW 2 122807594 missense possibly damaging 0.68
R6843:Sqor UTSW 2 122784980 missense probably benign 0.00
R6843:Sqor UTSW 2 122809295 missense probably damaging 0.99
R7193:Sqor UTSW 2 122804009 missense probably damaging 1.00
R7320:Sqor UTSW 2 122799810 missense probably benign
R7417:Sqor UTSW 2 122787530 missense probably benign 0.35
R7846:Sqor UTSW 2 122785088 missense probably benign 0.37
R7929:Sqor UTSW 2 122785088 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGAGCTGTGGGGCATATCCACC -3'
(R):5'- CACTGCATAACAAGGCAGGCTTTC -3'

Sequencing Primer
(F):5'- GCATATCCACCCCGCCTAC -3'
(R):5'- CAGAAAGAGCTTGTTTCTGCCAG -3'
Posted On2013-06-11