Mutagenetix > Incidental Mutation

Incidental Mutation 'R5664:Tbx3'

444250

Institutional Source

Beutler Lab

Gene Symbol

Tbx3

Ensembl Gene

ENSMUSG00000018604

Gene Name

T-box 3

Synonyms

D5Ertd189e

MMRRC Submission

043307-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119670669-119684724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119678731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 311 (K311R)

Ref Sequence

ENSEMBL: ENSMUSP00000078657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]

AlphaFold

P70324

Predicted Effect

probably benign
Transcript: ENSMUST00000018748
AA Change: K331R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: K331R

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	310	6.4e-125	SMART
Pfam:TBX	323	411	8.8e-29	PFAM
low complexity region	492	510	N/A	INTRINSIC
low complexity region	524	538	N/A	INTRINSIC
low complexity region	556	576	N/A	INTRINSIC
low complexity region	607	620	N/A	INTRINSIC
low complexity region	662	710	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079719
AA Change: K311R

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: K311R

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121021
AA Change: K311R

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: K311R

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154680

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,994		probably null	Het
1810032O08Rik	A	T	11: 116,672,664	T27S	possibly damaging	Het
4930432K21Rik	A	T	8: 84,166,659	I152F	probably benign	Het
9430015G10Rik	T	A	4: 156,123,559	L112H	probably damaging	Het
Acaca	T	C	11: 84,243,384	L441P	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Arsj	A	T	3: 126,438,657	I351F	probably damaging	Het
Atp6v1b2	A	G	8: 69,107,620	T373A	probably damaging	Het
Atr	C	A	9: 95,905,813	N1486K	probably benign	Het
Avl9	T	C	6: 56,753,839	S583P	probably damaging	Het
Bptf	A	T	11: 107,073,699	D1493E	probably benign	Het
C2cd2l	T	C	9: 44,313,772	E548G	probably damaging	Het
Capn3	G	A	2: 120,477,025	R15Q	probably benign	Het
Ccl3	A	G	11: 83,649,213	F22S	probably benign	Het
Clcf1	T	C	19: 4,222,096	F69S	probably damaging	Het
Col13a1	T	C	10: 61,851,116	E170G	probably damaging	Het
Dhx29	T	A	13: 112,946,879	F489L	probably damaging	Het
Dhx8	A	T	11: 101,740,751	N390I	probably damaging	Het
Dkk1	T	A	19: 30,548,789	Y135F	probably benign	Het
Edil3	G	T	13: 89,319,713	V446F	probably damaging	Het
Epha5	T	A	5: 84,331,866	E93V	probably damaging	Het
Epsti1	C	T	14: 77,963,664	T196I	possibly damaging	Het
Fras1	T	C	5: 96,728,535	S2376P	possibly damaging	Het
Frem2	A	G	3: 53,652,490	V1532A	probably benign	Het
Fsip2	T	A	2: 82,988,095	M4724K	probably benign	Het
Gcat	T	A	15: 79,043,073	L238Q	probably damaging	Het
Gimap6	T	C	6: 48,702,275	K276E	probably benign	Het
Gjb5	T	A	4: 127,355,929	I141F	probably benign	Het
Glt6d1	T	C	2: 25,814,180	I7V	probably benign	Het
Gm37596	A	G	3: 93,692,687	F125S	probably benign	Het
Gm5771	C	T	6: 41,394,671	P17L	probably benign	Het
Gm6169	C	A	13: 97,099,121	L39F	probably damaging	Het
Gtf2h5	G	A	17: 6,084,524	G30R	probably damaging	Het
Herc6	C	A	6: 57,618,684	T449K	probably benign	Het
Hpn	A	T	7: 31,099,262	Y132N	probably damaging	Het
Hpx	A	T	7: 105,595,148	M190K	probably benign	Het
Inf2	A	G	12: 112,611,728	H1151R	unknown	Het
Krt74	A	G	15: 101,760,579		noncoding transcript	Het
Loxl3	G	A	6: 83,049,882	S564N	probably benign	Het
Map7	T	A	10: 20,267,359	V418E	unknown	Het
Mrpl37	T	C	4: 107,064,391	N214D	probably benign	Het
Mthfr	T	C	4: 148,055,466	Y656H	probably damaging	Het
Myo9b	A	G	8: 71,359,882	D2099G	probably benign	Het
Nktr	T	A	9: 121,749,417	C825*	probably null	Het
Nomo1	A	G	7: 46,076,157	E1029G	probably benign	Het
Nup133	T	C	8: 123,906,281	D1037G	probably benign	Het
Olfr1271	A	G	2: 90,265,615	F272L	probably damaging	Het
Olfr153	T	C	2: 87,532,834	L267P	probably benign	Het
Pcdhb14	T	A	18: 37,448,996	V385D	possibly damaging	Het
Pik3c2g	T	C	6: 139,737,007	L38P	probably damaging	Het
Pkd1	A	T	17: 24,569,371	D701V	probably damaging	Het
Pnpla6	A	G	8: 3,537,478	T1070A	probably damaging	Het
Ppl	T	C	16: 5,106,055	D185G	probably benign	Het
Prune1	A	T	3: 95,258,178	L261Q	probably damaging	Het
Qser1	A	T	2: 104,778,196	L1444I	probably damaging	Het
Serpina6	A	C	12: 103,654,467	C8G	probably damaging	Het
Sla2	A	T	2: 156,874,999	D180E	probably benign	Het
Slc4a4	C	T	5: 89,028,244	L25F	probably damaging	Het
Thbs2	A	T	17: 14,689,837	C167S	probably damaging	Het
Trak1	T	A	9: 121,472,307	C710S	possibly damaging	Het
Tsks	G	A	7: 44,953,784	E337K	probably damaging	Het
Vcpip1	A	G	1: 9,746,379	I593T	probably damaging	Het
Vmn2r118	A	G	17: 55,592,765	I713T	possibly damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r68	A	T	7: 85,233,770	M258K	probably benign	Het
Vmn2r76	A	G	7: 86,245,994		probably null	Het
Wap	A	G	11: 6,638,609	I5T	possibly damaging	Het
Zfp235	A	C	7: 24,142,151	H665P	probably damaging	Het

Other mutations in Tbx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01960:Tbx3	APN	5	119682643	missense	probably benign	0.45
IGL02174:Tbx3	APN	5	119675584	nonsense	probably null
IGL02508:Tbx3	APN	5	119678812	missense	possibly damaging	0.48
IGL03035:Tbx3	APN	5	119683096	utr 3 prime	probably benign
R0047:Tbx3	UTSW	5	119680446	missense	probably damaging	0.99
R0184:Tbx3	UTSW	5	119675562	missense	probably damaging	1.00
R0365:Tbx3	UTSW	5	119675250	missense	possibly damaging	0.81
R1209:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R1956:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R2231:Tbx3	UTSW	5	119677524	missense	probably damaging	1.00
R4093:Tbx3	UTSW	5	119680748	missense	probably benign
R4400:Tbx3	UTSW	5	119680571	missense	probably damaging	0.99
R4578:Tbx3	UTSW	5	119682776	missense	probably damaging	0.99
R4693:Tbx3	UTSW	5	119677570	missense	possibly damaging	0.72
R4716:Tbx3	UTSW	5	119675670	missense	possibly damaging	0.94
R4804:Tbx3	UTSW	5	119680512	missense	possibly damaging	0.63
R5724:Tbx3	UTSW	5	119675603	missense	possibly damaging	0.75
R5990:Tbx3	UTSW	5	119680529	missense	probably benign	0.02
R6133:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R6180:Tbx3	UTSW	5	119674067	missense	probably damaging	1.00
R6429:Tbx3	UTSW	5	119674191	nonsense	probably null
R7154:Tbx3	UTSW	5	119672028	missense	possibly damaging	0.89
R7195:Tbx3	UTSW	5	119675583	missense	probably damaging	1.00
R7352:Tbx3	UTSW	5	119677560	missense	probably benign	0.00
R7921:Tbx3	UTSW	5	119680869	missense	possibly damaging	0.76
R7921:Tbx3	UTSW	5	119680870	missense	probably benign	0.01
R8050:Tbx3	UTSW	5	119683067	missense	probably benign	0.38
R8089:Tbx3	UTSW	5	119680569	missense	probably damaging	0.98
R8351:Tbx3	UTSW	5	119680776	missense	probably damaging	1.00
R8422:Tbx3	UTSW	5	119680516	missense	possibly damaging	0.94
R8885:Tbx3	UTSW	5	119680559	missense	probably benign
R8891:Tbx3	UTSW	5	119671918	start gained	probably benign
R8987:Tbx3	UTSW	5	119680821	missense	possibly damaging	0.78
R9240:Tbx3	UTSW	5	119680895	missense	probably benign
X0063:Tbx3	UTSW	5	119680881	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTCCCAGTTAAACAGGC -3'
(R):5'- TAACTCCTAAAGCCTCGGGG -3'

Sequencing Primer
(F):5'- CCCAGGGTCAGAACATGTC -3'
(R):5'- CTCGGGGGCCAAGAAGC -3'

Posted On

2016-11-09