Mutagenetix > Incidental Mutation

Incidental Mutation 'R5664:Vmn2r68'

444264

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

043307-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R5664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85233770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 258 (M258K)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061074
AA Change: M258K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M258K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,994		probably null	Het
1810032O08Rik	A	T	11: 116,672,664	T27S	possibly damaging	Het
4930432K21Rik	A	T	8: 84,166,659	I152F	probably benign	Het
9430015G10Rik	T	A	4: 156,123,559	L112H	probably damaging	Het
Acaca	T	C	11: 84,243,384	L441P	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Arsj	A	T	3: 126,438,657	I351F	probably damaging	Het
Atp6v1b2	A	G	8: 69,107,620	T373A	probably damaging	Het
Atr	C	A	9: 95,905,813	N1486K	probably benign	Het
Avl9	T	C	6: 56,753,839	S583P	probably damaging	Het
Bptf	A	T	11: 107,073,699	D1493E	probably benign	Het
C2cd2l	T	C	9: 44,313,772	E548G	probably damaging	Het
Capn3	G	A	2: 120,477,025	R15Q	probably benign	Het
Ccl3	A	G	11: 83,649,213	F22S	probably benign	Het
Clcf1	T	C	19: 4,222,096	F69S	probably damaging	Het
Col13a1	T	C	10: 61,851,116	E170G	probably damaging	Het
Dhx29	T	A	13: 112,946,879	F489L	probably damaging	Het
Dhx8	A	T	11: 101,740,751	N390I	probably damaging	Het
Dkk1	T	A	19: 30,548,789	Y135F	probably benign	Het
Edil3	G	T	13: 89,319,713	V446F	probably damaging	Het
Epha5	T	A	5: 84,331,866	E93V	probably damaging	Het
Epsti1	C	T	14: 77,963,664	T196I	possibly damaging	Het
Fras1	T	C	5: 96,728,535	S2376P	possibly damaging	Het
Frem2	A	G	3: 53,652,490	V1532A	probably benign	Het
Fsip2	T	A	2: 82,988,095	M4724K	probably benign	Het
Gcat	T	A	15: 79,043,073	L238Q	probably damaging	Het
Gimap6	T	C	6: 48,702,275	K276E	probably benign	Het
Gjb5	T	A	4: 127,355,929	I141F	probably benign	Het
Glt6d1	T	C	2: 25,814,180	I7V	probably benign	Het
Gm37596	A	G	3: 93,692,687	F125S	probably benign	Het
Gm5771	C	T	6: 41,394,671	P17L	probably benign	Het
Gm6169	C	A	13: 97,099,121	L39F	probably damaging	Het
Gtf2h5	G	A	17: 6,084,524	G30R	probably damaging	Het
Herc6	C	A	6: 57,618,684	T449K	probably benign	Het
Hpn	A	T	7: 31,099,262	Y132N	probably damaging	Het
Hpx	A	T	7: 105,595,148	M190K	probably benign	Het
Inf2	A	G	12: 112,611,728	H1151R	unknown	Het
Krt74	A	G	15: 101,760,579		noncoding transcript	Het
Loxl3	G	A	6: 83,049,882	S564N	probably benign	Het
Map7	T	A	10: 20,267,359	V418E	unknown	Het
Mrpl37	T	C	4: 107,064,391	N214D	probably benign	Het
Mthfr	T	C	4: 148,055,466	Y656H	probably damaging	Het
Myo9b	A	G	8: 71,359,882	D2099G	probably benign	Het
Nktr	T	A	9: 121,749,417	C825*	probably null	Het
Nomo1	A	G	7: 46,076,157	E1029G	probably benign	Het
Nup133	T	C	8: 123,906,281	D1037G	probably benign	Het
Olfr1271	A	G	2: 90,265,615	F272L	probably damaging	Het
Olfr153	T	C	2: 87,532,834	L267P	probably benign	Het
Pcdhb14	T	A	18: 37,448,996	V385D	possibly damaging	Het
Pik3c2g	T	C	6: 139,737,007	L38P	probably damaging	Het
Pkd1	A	T	17: 24,569,371	D701V	probably damaging	Het
Pnpla6	A	G	8: 3,537,478	T1070A	probably damaging	Het
Ppl	T	C	16: 5,106,055	D185G	probably benign	Het
Prune1	A	T	3: 95,258,178	L261Q	probably damaging	Het
Qser1	A	T	2: 104,778,196	L1444I	probably damaging	Het
Serpina6	A	C	12: 103,654,467	C8G	probably damaging	Het
Sla2	A	T	2: 156,874,999	D180E	probably benign	Het
Slc4a4	C	T	5: 89,028,244	L25F	probably damaging	Het
Tbx3	A	G	5: 119,678,731	K311R	possibly damaging	Het
Thbs2	A	T	17: 14,689,837	C167S	probably damaging	Het
Trak1	T	A	9: 121,472,307	C710S	possibly damaging	Het
Tsks	G	A	7: 44,953,784	E337K	probably damaging	Het
Vcpip1	A	G	1: 9,746,379	I593T	probably damaging	Het
Vmn2r118	A	G	17: 55,592,765	I713T	possibly damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r76	A	G	7: 86,245,994		probably null	Het
Wap	A	G	11: 6,638,609	I5T	possibly damaging	Het
Zfp235	A	C	7: 24,142,151	H665P	probably damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACCAGATAGTTCAGGTTTCTGGTG -3'
(R):5'- GCGATGGTTTCCCTAATGGTTC -3'

Sequencing Primer
(F):5'- ATGTCCCAGAGGAGGAAT -3'
(R):5'- CCCTAATGGTTCATTTCAGATGG -3'

Posted On

2016-11-09