Incidental Mutation 'H8786:Tmc2'
ID44427
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Nametransmembrane channel-like gene family 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130195194-130264445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130226262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 234 (Y234C)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: Y234C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: Y234C

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: Y234C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: Y234C

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130247960 missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R3968:Tmc2 UTSW 2 130202071 missense probably benign 0.02
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130234818 missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130234804 missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130208296
Predicted Primers PCR Primer
(F):5'- CTGCCATAAGAAAGCAGAGTCCTGG -3'
(R):5'- AGAGAACTTGTCTCCTAACCCCTTACC -3'

Sequencing Primer
(F):5'- CCTGGGGATTTATCTGACAGAC -3'
(R):5'- ttgagtggaatgaggcagg -3'
Posted On2013-06-11