Mutagenetix > Incidental Mutations

Incidental Mutation 'R5664:Nup133'

444272

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

043307-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5664 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123906281 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1037 (D1037G)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

Predicted Effect

probably benign
Transcript: ENSMUST00000044795
AA Change: D1037G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: D1037G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	T	A	6: 72,348,994		probably null	Het
1810032O08Rik	A	T	11: 116,672,664	T27S	possibly damaging	Het
4930432K21Rik	A	T	8: 84,166,659	I152F	probably benign	Het
9430015G10Rik	T	A	4: 156,123,559	L112H	probably damaging	Het
Acaca	T	C	11: 84,243,384	L441P	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Arsj	A	T	3: 126,438,657	I351F	probably damaging	Het
Atp6v1b2	A	G	8: 69,107,620	T373A	probably damaging	Het
Atr	C	A	9: 95,905,813	N1486K	probably benign	Het
Avl9	T	C	6: 56,753,839	S583P	probably damaging	Het
Bptf	A	T	11: 107,073,699	D1493E	probably benign	Het
C2cd2l	T	C	9: 44,313,772	E548G	probably damaging	Het
Capn3	G	A	2: 120,477,025	R15Q	probably benign	Het
Ccl3	A	G	11: 83,649,213	F22S	probably benign	Het
Clcf1	T	C	19: 4,222,096	F69S	probably damaging	Het
Col13a1	T	C	10: 61,851,116	E170G	probably damaging	Het
Dhx29	T	A	13: 112,946,879	F489L	probably damaging	Het
Dhx8	A	T	11: 101,740,751	N390I	probably damaging	Het
Dkk1	T	A	19: 30,548,789	Y135F	probably benign	Het
Edil3	G	T	13: 89,319,713	V446F	probably damaging	Het
Epha5	T	A	5: 84,331,866	E93V	probably damaging	Het
Epsti1	C	T	14: 77,963,664	T196I	possibly damaging	Het
Fras1	T	C	5: 96,728,535	S2376P	possibly damaging	Het
Frem2	A	G	3: 53,652,490	V1532A	probably benign	Het
Fsip2	T	A	2: 82,988,095	M4724K	probably benign	Het
Gcat	T	A	15: 79,043,073	L238Q	probably damaging	Het
Gimap6	T	C	6: 48,702,275	K276E	probably benign	Het
Gjb5	T	A	4: 127,355,929	I141F	probably benign	Het
Glt6d1	T	C	2: 25,814,180	I7V	probably benign	Het
Gm37596	A	G	3: 93,692,687	F125S	probably benign	Het
Gm5771	C	T	6: 41,394,671	P17L	probably benign	Het
Gm6169	C	A	13: 97,099,121	L39F	probably damaging	Het
Gtf2h5	G	A	17: 6,084,524	G30R	probably damaging	Het
Herc6	C	A	6: 57,618,684	T449K	probably benign	Het
Hpn	A	T	7: 31,099,262	Y132N	probably damaging	Het
Hpx	A	T	7: 105,595,148	M190K	probably benign	Het
Inf2	A	G	12: 112,611,728	H1151R	unknown	Het
Krt74	A	G	15: 101,760,579		noncoding transcript	Het
Loxl3	G	A	6: 83,049,882	S564N	probably benign	Het
Map7	T	A	10: 20,267,359	V418E	unknown	Het
Mrpl37	T	C	4: 107,064,391	N214D	probably benign	Het
Mthfr	T	C	4: 148,055,466	Y656H	probably damaging	Het
Myo9b	A	G	8: 71,359,882	D2099G	probably benign	Het
Nktr	T	A	9: 121,749,417	C825*	probably null	Het
Nomo1	A	G	7: 46,076,157	E1029G	probably benign	Het
Olfr1271	A	G	2: 90,265,615	F272L	probably damaging	Het
Olfr153	T	C	2: 87,532,834	L267P	probably benign	Het
Pcdhb14	T	A	18: 37,448,996	V385D	possibly damaging	Het
Pik3c2g	T	C	6: 139,737,007	L38P	probably damaging	Het
Pkd1	A	T	17: 24,569,371	D701V	probably damaging	Het
Pnpla6	A	G	8: 3,537,478	T1070A	probably damaging	Het
Ppl	T	C	16: 5,106,055	D185G	probably benign	Het
Prune1	A	T	3: 95,258,178	L261Q	probably damaging	Het
Qser1	A	T	2: 104,778,196	L1444I	probably damaging	Het
Serpina6	A	C	12: 103,654,467	C8G	probably damaging	Het
Sla2	A	T	2: 156,874,999	D180E	probably benign	Het
Slc4a4	C	T	5: 89,028,244	L25F	probably damaging	Het
Tbx3	A	G	5: 119,678,731	K311R	possibly damaging	Het
Thbs2	A	T	17: 14,689,837	C167S	probably damaging	Het
Trak1	T	A	9: 121,472,307	C710S	possibly damaging	Het
Tsks	G	A	7: 44,953,784	E337K	probably damaging	Het
Vcpip1	A	G	1: 9,746,379	I593T	probably damaging	Het
Vmn2r118	A	G	17: 55,592,765	I713T	possibly damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r68	A	T	7: 85,233,770	M258K	probably benign	Het
Vmn2r76	A	G	7: 86,245,994		probably null	Het
Wap	A	G	11: 6,638,609	I5T	possibly damaging	Het
Zfp235	A	C	7: 24,142,151	H665P	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGATGCCTGAGACAGTGTGTTTTC -3'
(R):5'- ACCTACTGGAAAGCTTGTGC -3'

Sequencing Primer
(F):5'- GTCCTGGAAATCACTCTGTAGAC -3'
(R):5'- CCTACTGGAAAGCTTGTGCTATATTC -3'

Posted On

2016-11-09