Incidental Mutation 'H8786:Tln1'
ID44430
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43544589 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1113 (N1113K)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: N1113K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: N1113K

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCTGACCTGAGCAAGCCTTTG -3'
(R):5'- TCATTGAAACCGCCAGCCTTCC -3'

Sequencing Primer
(F):5'- CTGGCTGTGTCAAGCACAATG -3'
(R):5'- TCCCCAAGAACTTTCTCAGATG -3'
Posted On2013-06-11