Mutagenetix > Incidental Mutation

Incidental Mutation 'R5665:Col6a3'

444305

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

043308-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5665 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90694582-90771710 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90755602 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 229 (E229G)

Ref Sequence

ENSEMBL: ENSMUSP00000115210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000187753] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000056925
AA Change: E229G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: E229G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097653

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130846
AA Change: E229G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: E229G

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000187753

SMART Domains

Protein: ENSMUSP00000140280
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:VWA	35	74	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188587

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,376,349 (GRCm39)	V173M	probably damaging	Het
Acaca	G	T	11: 84,136,120 (GRCm39)	E492*	probably null	Het
Acp7	T	A	7: 28,315,968 (GRCm39)	K206M	probably benign	Het
Agbl1	T	A	7: 76,239,251 (GRCm39)	F584I	probably damaging	Het
Ahi1	A	G	10: 20,930,946 (GRCm39)	I929V	possibly damaging	Het
Ank3	G	A	10: 69,838,395 (GRCm39)	R1566K	possibly damaging	Het
Arhgef40	A	G	14: 52,238,357 (GRCm39)	I1279V	possibly damaging	Het
Arl14	A	C	3: 69,130,371 (GRCm39)	T173P	probably damaging	Het
Asap1	A	G	15: 64,184,302 (GRCm39)	S44P	probably damaging	Het
Btbd7	C	A	12: 102,751,456 (GRCm39)	A1103S	probably benign	Het
Capn10	T	A	1: 92,865,653 (GRCm39)		probably null	Het
Capn7	T	C	14: 31,091,759 (GRCm39)	F719L	probably benign	Het
Casp7	G	A	19: 56,429,414 (GRCm39)	D267N	probably benign	Het
Ccdc13	C	A	9: 121,643,356 (GRCm39)	K348N	probably damaging	Het
Chchd1	T	C	14: 20,753,178 (GRCm39)	F13L	probably benign	Het
Clcn6	T	A	4: 148,099,018 (GRCm39)	M442L	possibly damaging	Het
Cyb5r3	A	G	15: 83,038,755 (GRCm39)	F278S	probably damaging	Het
Dhx16	C	T	17: 36,201,978 (GRCm39)	Q1002*	probably null	Het
Dppa4	T	C	16: 48,111,378 (GRCm39)	L121P	probably benign	Het
Dpyd	A	G	3: 118,710,741 (GRCm39)	E383G	probably damaging	Het
Eif4g3	A	G	4: 137,853,900 (GRCm39)	T489A	probably benign	Het
Elovl1	G	T	4: 118,288,832 (GRCm39)	V174L	probably damaging	Het
Elp3	T	C	14: 65,788,851 (GRCm39)	K392E	possibly damaging	Het
Fancd2os	C	A	6: 113,574,985 (GRCm39)	W7L	probably damaging	Het
Fchsd2	A	G	7: 100,759,991 (GRCm39)	T23A	possibly damaging	Het
Gabrp	C	G	11: 33,504,308 (GRCm39)	A336P	possibly damaging	Het
Gcm2	T	A	13: 41,263,387 (GRCm39)	Y15F	possibly damaging	Het
Gpr132	G	A	12: 112,816,416 (GRCm39)	R137C	probably damaging	Het
Herc1	A	G	9: 66,372,717 (GRCm39)	E3091G	probably damaging	Het
Homer1	A	T	13: 93,492,610 (GRCm39)	M184L	probably benign	Het
Izumo1r	T	C	9: 14,812,145 (GRCm39)	E117G	probably damaging	Het
Kcnt1	C	T	2: 25,791,921 (GRCm39)	Q590*	probably null	Het
Lama1	G	T	17: 68,077,982 (GRCm39)	C1139F	probably damaging	Het
Med29	C	T	7: 28,086,239 (GRCm39)	A190T	probably benign	Het
Muc4	T	C	16: 32,569,600 (GRCm39)	V220A	probably benign	Het
Mxra8	G	T	4: 155,927,378 (GRCm39)	V388L	probably benign	Het
Myo5a	T	C	9: 75,051,463 (GRCm39)		probably null	Het
Myrip	A	G	9: 120,290,499 (GRCm39)	Y706C	probably damaging	Het
Nphp4	T	C	4: 152,590,942 (GRCm39)	V313A	probably benign	Het
Oga	A	C	19: 45,765,436 (GRCm39)	S124A	probably benign	Het
Olfm2	T	G	9: 20,579,840 (GRCm39)		probably null	Het
Or10ag52	T	A	2: 87,044,072 (GRCm39)	S279T	probably benign	Het
Or10x4	T	C	1: 174,218,941 (GRCm39)	F102S	probably damaging	Het
Pcdh15	C	T	10: 74,462,620 (GRCm39)	P1398L	probably damaging	Het
Pdpr	A	G	8: 111,841,443 (GRCm39)	E225G	possibly damaging	Het
Pigs	C	A	11: 78,219,595 (GRCm39)		probably null	Het
Pkhd1	T	A	1: 20,658,755 (GRCm39)	T159S	probably damaging	Het
Plk4	A	G	3: 40,768,021 (GRCm39)	T87A	possibly damaging	Het
Plxna4	T	C	6: 32,192,657 (GRCm39)	Y768C	probably damaging	Het
Prl3d3	T	A	13: 27,343,064 (GRCm39)		probably null	Het
Pygb	T	C	2: 150,662,808 (GRCm39)		probably null	Het
Rnf114	T	C	2: 167,352,854 (GRCm39)	I118T	possibly damaging	Het
Sbno2	A	G	10: 79,894,287 (GRCm39)	L1099P	probably benign	Het
Scaper	T	C	9: 55,714,916 (GRCm39)	K791E	probably damaging	Het
Serping1	T	C	2: 84,601,889 (GRCm39)	T194A	probably damaging	Het
Slc12a9	A	G	5: 137,319,665 (GRCm39)	S617P	possibly damaging	Het
Slk	G	A	19: 47,624,896 (GRCm39)	R1039H	probably damaging	Het
Sntb1	T	A	15: 55,655,535 (GRCm39)	E227V	probably benign	Het
Sostdc1	C	A	12: 36,364,407 (GRCm39)	P39T	probably benign	Het
Spred1	C	T	2: 116,983,486 (GRCm39)	R16*	probably null	Het
Srpk2	A	G	5: 23,723,475 (GRCm39)	I547T	probably damaging	Het
Stt3a	A	G	9: 36,670,610 (GRCm39)	Y54H	probably damaging	Het
Stt3b	A	T	9: 115,095,215 (GRCm39)	L272H	probably damaging	Het
Syne2	T	A	12: 76,154,991 (GRCm39)		probably null	Het
Uso1	A	T	5: 92,346,196 (GRCm39)	E793V	possibly damaging	Het
Usp15	A	T	10: 122,966,892 (GRCm39)	L476*	probably null	Het
Vmn1r189	T	C	13: 22,286,336 (GRCm39)	Y167C	probably damaging	Het
Vmn2r24	A	G	6: 123,763,938 (GRCm39)	T272A	possibly damaging	Het
Vps13a	A	T	19: 16,646,054 (GRCm39)	H1994Q	probably damaging	Het
Zbtb10	T	C	3: 9,330,252 (GRCm39)	S537P	probably damaging	Het
Zbtb12	T	C	17: 35,114,859 (GRCm39)	S215P	possibly damaging	Het
Zfp346	T	C	13: 55,260,915 (GRCm39)	M81T	probably benign	Het
Zfp800	T	C	6: 28,244,512 (GRCm39)	D151G	probably null	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90,755,977 (GRCm39)	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90,709,748 (GRCm39)	missense	unknown
IGL00541:Col6a3	APN	1	90,729,864 (GRCm39)	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90,730,054 (GRCm39)	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90,731,655 (GRCm39)	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90,735,232 (GRCm39)	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90,730,236 (GRCm39)	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90,706,884 (GRCm39)	missense	unknown
IGL01827:Col6a3	APN	1	90,730,041 (GRCm39)	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90,724,293 (GRCm39)	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90,700,770 (GRCm39)	missense	unknown
IGL01900:Col6a3	APN	1	90,722,732 (GRCm39)	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90,729,958 (GRCm39)	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90,709,858 (GRCm39)	splice site	probably benign
IGL02115:Col6a3	APN	1	90,735,373 (GRCm39)	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90,709,482 (GRCm39)	missense	unknown
IGL02313:Col6a3	APN	1	90,739,328 (GRCm39)	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90,706,919 (GRCm39)	missense	unknown
IGL02821:Col6a3	APN	1	90,731,600 (GRCm39)	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90,724,281 (GRCm39)	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90,739,242 (GRCm39)	nonsense	probably null
IGL03129:Col6a3	APN	1	90,749,584 (GRCm39)	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90,731,615 (GRCm39)	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90,755,588 (GRCm39)	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90,737,898 (GRCm39)	missense	probably damaging	1.00
bailey	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
barnum	UTSW	1	90,706,874 (GRCm39)	missense	unknown
Boneless	UTSW	1	90,706,781 (GRCm39)	missense	unknown
Noodloid	UTSW	1	90,707,011 (GRCm39)	missense	unknown
randolf	UTSW	1	90,715,673 (GRCm39)	missense	unknown
stringy	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
wonder	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90,737,970 (GRCm39)	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90,706,516 (GRCm39)	missense	unknown
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90,725,883 (GRCm39)	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90,741,273 (GRCm39)	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90,725,895 (GRCm39)	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90,735,426 (GRCm39)	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90,755,771 (GRCm39)	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R0512:Col6a3	UTSW	1	90,749,520 (GRCm39)	intron	probably benign
R0564:Col6a3	UTSW	1	90,735,456 (GRCm39)	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90,735,808 (GRCm39)	splice site	probably null
R0667:Col6a3	UTSW	1	90,755,823 (GRCm39)	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90,706,703 (GRCm39)	missense	unknown
R0736:Col6a3	UTSW	1	90,731,811 (GRCm39)	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90,756,020 (GRCm39)	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90,730,375 (GRCm39)	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90,722,047 (GRCm39)	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1225:Col6a3	UTSW	1	90,739,238 (GRCm39)	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90,696,069 (GRCm39)	missense	unknown
R1387:Col6a3	UTSW	1	90,750,138 (GRCm39)	intron	probably benign
R1437:Col6a3	UTSW	1	90,729,098 (GRCm39)	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1677:Col6a3	UTSW	1	90,749,583 (GRCm39)	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90,701,224 (GRCm39)	missense	unknown
R1711:Col6a3	UTSW	1	90,757,935 (GRCm39)	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90,724,296 (GRCm39)	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90,706,781 (GRCm39)	missense	unknown
R1738:Col6a3	UTSW	1	90,744,083 (GRCm39)	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90,741,516 (GRCm39)	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90,755,671 (GRCm39)	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90,757,936 (GRCm39)	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90,739,421 (GRCm39)	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90,750,081 (GRCm39)	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90,731,897 (GRCm39)	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90,709,733 (GRCm39)	missense	unknown
R2121:Col6a3	UTSW	1	90,738,087 (GRCm39)	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90,731,467 (GRCm39)	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90,741,080 (GRCm39)	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90,731,435 (GRCm39)	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90,703,321 (GRCm39)	missense	unknown
R3052:Col6a3	UTSW	1	90,729,852 (GRCm39)	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90,707,803 (GRCm39)	missense	unknown
R4007:Col6a3	UTSW	1	90,730,291 (GRCm39)	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90,749,605 (GRCm39)	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90,729,105 (GRCm39)	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90,714,361 (GRCm39)	missense	unknown
R4297:Col6a3	UTSW	1	90,739,100 (GRCm39)	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90,709,626 (GRCm39)	missense	unknown
R4683:Col6a3	UTSW	1	90,701,179 (GRCm39)	missense	unknown
R4788:Col6a3	UTSW	1	90,700,672 (GRCm39)	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90,707,011 (GRCm39)	missense	unknown
R4899:Col6a3	UTSW	1	90,730,149 (GRCm39)	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90,729,164 (GRCm39)	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90,735,246 (GRCm39)	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90,731,940 (GRCm39)	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90,706,565 (GRCm39)	missense	unknown
R5057:Col6a3	UTSW	1	90,743,852 (GRCm39)	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90,707,074 (GRCm39)	missense	unknown
R5105:Col6a3	UTSW	1	90,725,862 (GRCm39)	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90,696,067 (GRCm39)	missense	unknown
R5166:Col6a3	UTSW	1	90,738,330 (GRCm39)	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90,701,361 (GRCm39)	nonsense	probably null
R5196:Col6a3	UTSW	1	90,744,260 (GRCm39)	splice site	probably null
R5230:Col6a3	UTSW	1	90,716,776 (GRCm39)	missense	unknown
R5268:Col6a3	UTSW	1	90,712,965 (GRCm39)	missense	unknown
R5381:Col6a3	UTSW	1	90,703,334 (GRCm39)	missense	unknown
R5392:Col6a3	UTSW	1	90,729,017 (GRCm39)	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90,709,761 (GRCm39)	nonsense	probably null
R5571:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R5902:Col6a3	UTSW	1	90,729,921 (GRCm39)	splice site	probably null
R5914:Col6a3	UTSW	1	90,703,922 (GRCm39)	missense	unknown
R5955:Col6a3	UTSW	1	90,739,163 (GRCm39)	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90,749,571 (GRCm39)	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90,696,105 (GRCm39)	missense	unknown
R6010:Col6a3	UTSW	1	90,701,219 (GRCm39)	missense	unknown
R6025:Col6a3	UTSW	1	90,755,824 (GRCm39)	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90,741,475 (GRCm39)	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90,701,387 (GRCm39)	missense	unknown
R6181:Col6a3	UTSW	1	90,744,096 (GRCm39)	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90,750,063 (GRCm39)	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90,749,955 (GRCm39)	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90,738,285 (GRCm39)	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90,709,534 (GRCm39)	missense	unknown
R6484:Col6a3	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6703:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6703:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6724:Col6a3	UTSW	1	90,706,874 (GRCm39)	missense	unknown
R6746:Col6a3	UTSW	1	90,706,767 (GRCm39)	missense	unknown
R6797:Col6a3	UTSW	1	90,731,810 (GRCm39)	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90,722,731 (GRCm39)	splice site	probably null
R6903:Col6a3	UTSW	1	90,721,929 (GRCm39)	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90,743,724 (GRCm39)	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90,735,192 (GRCm39)	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90,755,759 (GRCm39)	nonsense	probably null
R7182:Col6a3	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
R7294:Col6a3	UTSW	1	90,756,005 (GRCm39)	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90,755,708 (GRCm39)	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90,750,013 (GRCm39)	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90,755,855 (GRCm39)	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90,703,463 (GRCm39)	missense	unknown
R7575:Col6a3	UTSW	1	90,738,321 (GRCm39)	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90,709,467 (GRCm39)	missense	unknown
R7679:Col6a3	UTSW	1	90,739,473 (GRCm39)	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90,724,268 (GRCm39)	nonsense	probably null
R7855:Col6a3	UTSW	1	90,738,343 (GRCm39)	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R8003:Col6a3	UTSW	1	90,703,455 (GRCm39)	missense	unknown
R8007:Col6a3	UTSW	1	90,705,179 (GRCm39)	missense	unknown
R8098:Col6a3	UTSW	1	90,731,383 (GRCm39)	missense	probably benign
R8312:Col6a3	UTSW	1	90,741,412 (GRCm39)	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90,729,935 (GRCm39)	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90,727,747 (GRCm39)	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90,696,171 (GRCm39)	missense	unknown
R8857:Col6a3	UTSW	1	90,703,485 (GRCm39)	missense	unknown
R8867:Col6a3	UTSW	1	90,715,673 (GRCm39)	missense	unknown
R8887:Col6a3	UTSW	1	90,755,948 (GRCm39)	missense	probably benign
R9011:Col6a3	UTSW	1	90,710,057 (GRCm39)	splice site	probably benign
R9049:Col6a3	UTSW	1	90,707,066 (GRCm39)	missense	unknown
R9142:Col6a3	UTSW	1	90,706,566 (GRCm39)	missense	unknown
R9155:Col6a3	UTSW	1	90,738,301 (GRCm39)	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9258:Col6a3	UTSW	1	90,700,703 (GRCm39)	missense	unknown
R9274:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9276:Col6a3	UTSW	1	90,735,403 (GRCm39)	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90,738,979 (GRCm39)	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90,709,523 (GRCm39)	missense	unknown
R9377:Col6a3	UTSW	1	90,743,961 (GRCm39)	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90,731,585 (GRCm39)	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90,744,155 (GRCm39)	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90,707,068 (GRCm39)	missense	unknown
R9441:Col6a3	UTSW	1	90,705,249 (GRCm39)	nonsense	probably null
R9477:Col6a3	UTSW	1	90,706,621 (GRCm39)	missense	unknown
R9498:Col6a3	UTSW	1	90,713,650 (GRCm39)	nonsense	probably null
R9528:Col6a3	UTSW	1	90,731,789 (GRCm39)	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90,731,497 (GRCm39)	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90,738,984 (GRCm39)	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90,738,282 (GRCm39)	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90,731,359 (GRCm39)	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90,731,627 (GRCm39)	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90,739,251 (GRCm39)	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90,739,450 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGTCCCCATTTGAAGGAGACTG -3'
(R):5'- CCCTCAGCGGAACTTAAGTC -3'

Sequencing Primer
(F):5'- CTGAAGAAGGATAGTCACGCCTTTG -3'
(R):5'- TCAGCGGAACTTAAGTCTGCGG -3'

Posted On

2016-11-09