Incidental Mutation 'H8786:Zcchc11'
ID44431
Institutional Source Beutler Lab
Gene Symbol Zcchc11
Ensembl Gene ENSMUSG00000034610
Gene Namezinc finger, CCHC domain containing 11
Synonyms6030404K05Rik, 9230115F04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108459426-108559421 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108550815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000128042]
Predicted Effect probably null
Transcript: ENSMUST00000043368
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097925
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127602
Predicted Effect probably benign
Transcript: ENSMUST00000128042
SMART Domains Protein: ENSMUSP00000116253
Gene: ENSMUSG00000034610

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151349
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Zcchc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zcchc11 APN 4 108550728 missense probably damaging 1.00
IGL00684:Zcchc11 APN 4 108479466 missense possibly damaging 0.80
IGL01598:Zcchc11 APN 4 108550820 unclassified probably benign
IGL01599:Zcchc11 APN 4 108513399 missense possibly damaging 0.85
IGL02088:Zcchc11 APN 4 108512218 splice site probably benign
IGL02451:Zcchc11 APN 4 108529276 nonsense probably null
IGL02667:Zcchc11 APN 4 108558708 splice site probably benign
IGL03080:Zcchc11 APN 4 108505824 missense probably damaging 1.00
IGL03374:Zcchc11 APN 4 108558777 missense probably damaging 1.00
IGL02799:Zcchc11 UTSW 4 108513528 missense probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0410:Zcchc11 UTSW 4 108486555 missense probably benign 0.27
R0698:Zcchc11 UTSW 4 108555533 missense probably benign 0.22
R0745:Zcchc11 UTSW 4 108502955 splice site probably benign
R1080:Zcchc11 UTSW 4 108479499 missense possibly damaging 0.82
R1774:Zcchc11 UTSW 4 108507955 missense probably damaging 1.00
R1809:Zcchc11 UTSW 4 108549355 missense probably damaging 1.00
R1869:Zcchc11 UTSW 4 108529300 missense probably damaging 1.00
R1874:Zcchc11 UTSW 4 108550725 missense probably damaging 1.00
R1958:Zcchc11 UTSW 4 108555706 missense probably damaging 1.00
R1976:Zcchc11 UTSW 4 108479523 missense probably benign 0.01
R2034:Zcchc11 UTSW 4 108512195 missense probably damaging 1.00
R2164:Zcchc11 UTSW 4 108503029 missense possibly damaging 0.73
R2251:Zcchc11 UTSW 4 108520208 missense probably damaging 1.00
R3001:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3002:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3003:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R4170:Zcchc11 UTSW 4 108548059 missense probably damaging 1.00
R4667:Zcchc11 UTSW 4 108495159 missense probably damaging 1.00
R4868:Zcchc11 UTSW 4 108549220 splice site probably benign
R4989:Zcchc11 UTSW 4 108526845 unclassified probably benign
R5014:Zcchc11 UTSW 4 108526846 unclassified probably benign
R5118:Zcchc11 UTSW 4 108520292 missense possibly damaging 0.92
R5431:Zcchc11 UTSW 4 108491412 missense probably damaging 1.00
R5645:Zcchc11 UTSW 4 108557373 missense probably damaging 1.00
R5661:Zcchc11 UTSW 4 108513187 missense probably benign 0.05
R5877:Zcchc11 UTSW 4 108512923 missense probably damaging 0.99
R6307:Zcchc11 UTSW 4 108555620 missense probably damaging 1.00
R6326:Zcchc11 UTSW 4 108478980 missense probably benign 0.02
R6407:Zcchc11 UTSW 4 108558782 missense probably damaging 1.00
R6493:Zcchc11 UTSW 4 108526805 missense probably damaging 1.00
R6587:Zcchc11 UTSW 4 108479449 missense probably benign
R7215:Zcchc11 UTSW 4 108527008 missense probably damaging 1.00
R7413:Zcchc11 UTSW 4 108549336 missense possibly damaging 0.69
R7584:Zcchc11 UTSW 4 108479346 missense probably benign 0.00
R7872:Zcchc11 UTSW 4 108517518 missense probably damaging 1.00
R7955:Zcchc11 UTSW 4 108517518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTAAAACAATGTGCCTGCCTGC -3'
(R):5'- ACGGGTCTCTTTCTCGGCAAGC -3'

Sequencing Primer
(F):5'- AATGTGCCTGCCTGCTTTTTC -3'
(R):5'- aaatgtgaggaggatggtgag -3'
Posted On2013-06-11