Incidental Mutation 'H8786:Avl9'
ID44432
Institutional Source Beutler Lab
Gene Symbol Avl9
Ensembl Gene ENSMUSG00000029787
Gene NameAVL9 cell migration associated
SynonymsD730049P16Rik, 5830411G16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location56714899-56761912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56757310 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 625 (A625T)
Ref Sequence ENSEMBL: ENSMUSP00000031805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031805]
Predicted Effect probably damaging
Transcript: ENSMUST00000031805
AA Change: A625T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031805
Gene: ENSMUSG00000029787
AA Change: A625T

DomainStartEndE-ValueType
Pfam:Afi1 15 102 3.8e-11 PFAM
Pfam:Avl9 16 521 7.1e-160 PFAM
Pfam:DUF2347 19 175 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176560
Meta Mutation Damage Score 0.2868 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Avl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avl9 APN 6 56725090 missense probably damaging 1.00
IGL01433:Avl9 APN 6 56753397 missense probably damaging 0.99
IGL02865:Avl9 APN 6 56736873 missense probably damaging 1.00
IGL02932:Avl9 APN 6 56736551 missense probably benign 0.00
Atlanta UTSW 6 56753390 missense possibly damaging 0.54
H8562:Avl9 UTSW 6 56757310 missense probably damaging 1.00
R0003:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0029:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0102:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0103:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0122:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0147:Avl9 UTSW 6 56736502 missense probably benign 0.00
R0372:Avl9 UTSW 6 56726324 critical splice donor site probably null
R0446:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0600:Avl9 UTSW 6 56736906 missense probably benign 0.03
R0667:Avl9 UTSW 6 56736483 missense probably benign 0.00
R1560:Avl9 UTSW 6 56725128 nonsense probably null
R1566:Avl9 UTSW 6 56736482 nonsense probably null
R2069:Avl9 UTSW 6 56736435 splice site probably benign
R2362:Avl9 UTSW 6 56736570 missense probably benign 0.07
R2483:Avl9 UTSW 6 56736843 missense probably benign
R2941:Avl9 UTSW 6 56753885 missense probably benign 0.00
R3028:Avl9 UTSW 6 56730687 unclassified probably benign
R3437:Avl9 UTSW 6 56736627 missense probably benign
R3690:Avl9 UTSW 6 56736827 missense probably benign
R3691:Avl9 UTSW 6 56736827 missense probably benign
R3947:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3948:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3949:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3972:Avl9 UTSW 6 56743408 missense probably damaging 1.00
R4734:Avl9 UTSW 6 56736494 missense probably damaging 0.96
R4739:Avl9 UTSW 6 56726309 missense probably damaging 1.00
R5661:Avl9 UTSW 6 56725102 nonsense probably null
R5664:Avl9 UTSW 6 56753839 missense probably damaging 1.00
R6010:Avl9 UTSW 6 56753390 missense possibly damaging 0.54
R6615:Avl9 UTSW 6 56753885 missense probably benign 0.00
R6719:Avl9 UTSW 6 56753385 missense probably damaging 1.00
R7138:Avl9 UTSW 6 56728257 missense probably damaging 1.00
R8030:Avl9 UTSW 6 56741422 missense probably damaging 0.99
Z1176:Avl9 UTSW 6 56736764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCCTATGGTGAAACATTACTCAG -3'
(R):5'- AGAGTGCAACCGTCCATGTAAACAG -3'

Sequencing Primer
(F):5'- ctcaaaaatccgcctgcc -3'
(R):5'- GTAAACAGTTTATCATCTTGGTCCC -3'
Posted On2013-06-11