Incidental Mutation 'R5665:Pdpr'
ID 444342
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Name pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms 4930402E16Rik
MMRRC Submission 043308-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R5665 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 111821262-111863706 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111841443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000046639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000135302] [ENSMUST00000144377]
AlphaFold Q7TSQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000039333
AA Change: E225G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624
AA Change: E225G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135302
SMART Domains Protein: ENSMUSP00000117570
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:DAO 43 145 4.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144377
AA Change: E225G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624
AA Change: E225G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acaca G T 11: 84,136,120 (GRCm39) E492* probably null Het
Acp7 T A 7: 28,315,968 (GRCm39) K206M probably benign Het
Agbl1 T A 7: 76,239,251 (GRCm39) F584I probably damaging Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Arhgef40 A G 14: 52,238,357 (GRCm39) I1279V possibly damaging Het
Arl14 A C 3: 69,130,371 (GRCm39) T173P probably damaging Het
Asap1 A G 15: 64,184,302 (GRCm39) S44P probably damaging Het
Btbd7 C A 12: 102,751,456 (GRCm39) A1103S probably benign Het
Capn10 T A 1: 92,865,653 (GRCm39) probably null Het
Capn7 T C 14: 31,091,759 (GRCm39) F719L probably benign Het
Casp7 G A 19: 56,429,414 (GRCm39) D267N probably benign Het
Ccdc13 C A 9: 121,643,356 (GRCm39) K348N probably damaging Het
Chchd1 T C 14: 20,753,178 (GRCm39) F13L probably benign Het
Clcn6 T A 4: 148,099,018 (GRCm39) M442L possibly damaging Het
Col6a3 T C 1: 90,755,602 (GRCm39) E229G probably benign Het
Cyb5r3 A G 15: 83,038,755 (GRCm39) F278S probably damaging Het
Dhx16 C T 17: 36,201,978 (GRCm39) Q1002* probably null Het
Dppa4 T C 16: 48,111,378 (GRCm39) L121P probably benign Het
Dpyd A G 3: 118,710,741 (GRCm39) E383G probably damaging Het
Eif4g3 A G 4: 137,853,900 (GRCm39) T489A probably benign Het
Elovl1 G T 4: 118,288,832 (GRCm39) V174L probably damaging Het
Elp3 T C 14: 65,788,851 (GRCm39) K392E possibly damaging Het
Fancd2os C A 6: 113,574,985 (GRCm39) W7L probably damaging Het
Fchsd2 A G 7: 100,759,991 (GRCm39) T23A possibly damaging Het
Gabrp C G 11: 33,504,308 (GRCm39) A336P possibly damaging Het
Gcm2 T A 13: 41,263,387 (GRCm39) Y15F possibly damaging Het
Gpr132 G A 12: 112,816,416 (GRCm39) R137C probably damaging Het
Herc1 A G 9: 66,372,717 (GRCm39) E3091G probably damaging Het
Homer1 A T 13: 93,492,610 (GRCm39) M184L probably benign Het
Izumo1r T C 9: 14,812,145 (GRCm39) E117G probably damaging Het
Kcnt1 C T 2: 25,791,921 (GRCm39) Q590* probably null Het
Lama1 G T 17: 68,077,982 (GRCm39) C1139F probably damaging Het
Med29 C T 7: 28,086,239 (GRCm39) A190T probably benign Het
Muc4 T C 16: 32,569,600 (GRCm39) V220A probably benign Het
Mxra8 G T 4: 155,927,378 (GRCm39) V388L probably benign Het
Myo5a T C 9: 75,051,463 (GRCm39) probably null Het
Myrip A G 9: 120,290,499 (GRCm39) Y706C probably damaging Het
Nphp4 T C 4: 152,590,942 (GRCm39) V313A probably benign Het
Oga A C 19: 45,765,436 (GRCm39) S124A probably benign Het
Olfm2 T G 9: 20,579,840 (GRCm39) probably null Het
Or10ag52 T A 2: 87,044,072 (GRCm39) S279T probably benign Het
Or10x4 T C 1: 174,218,941 (GRCm39) F102S probably damaging Het
Pcdh15 C T 10: 74,462,620 (GRCm39) P1398L probably damaging Het
Pigs C A 11: 78,219,595 (GRCm39) probably null Het
Pkhd1 T A 1: 20,658,755 (GRCm39) T159S probably damaging Het
Plk4 A G 3: 40,768,021 (GRCm39) T87A possibly damaging Het
Plxna4 T C 6: 32,192,657 (GRCm39) Y768C probably damaging Het
Prl3d3 T A 13: 27,343,064 (GRCm39) probably null Het
Pygb T C 2: 150,662,808 (GRCm39) probably null Het
Rnf114 T C 2: 167,352,854 (GRCm39) I118T possibly damaging Het
Sbno2 A G 10: 79,894,287 (GRCm39) L1099P probably benign Het
Scaper T C 9: 55,714,916 (GRCm39) K791E probably damaging Het
Serping1 T C 2: 84,601,889 (GRCm39) T194A probably damaging Het
Slc12a9 A G 5: 137,319,665 (GRCm39) S617P possibly damaging Het
Slk G A 19: 47,624,896 (GRCm39) R1039H probably damaging Het
Sntb1 T A 15: 55,655,535 (GRCm39) E227V probably benign Het
Sostdc1 C A 12: 36,364,407 (GRCm39) P39T probably benign Het
Spred1 C T 2: 116,983,486 (GRCm39) R16* probably null Het
Srpk2 A G 5: 23,723,475 (GRCm39) I547T probably damaging Het
Stt3a A G 9: 36,670,610 (GRCm39) Y54H probably damaging Het
Stt3b A T 9: 115,095,215 (GRCm39) L272H probably damaging Het
Syne2 T A 12: 76,154,991 (GRCm39) probably null Het
Uso1 A T 5: 92,346,196 (GRCm39) E793V possibly damaging Het
Usp15 A T 10: 122,966,892 (GRCm39) L476* probably null Het
Vmn1r189 T C 13: 22,286,336 (GRCm39) Y167C probably damaging Het
Vmn2r24 A G 6: 123,763,938 (GRCm39) T272A possibly damaging Het
Vps13a A T 19: 16,646,054 (GRCm39) H1994Q probably damaging Het
Zbtb10 T C 3: 9,330,252 (GRCm39) S537P probably damaging Het
Zbtb12 T C 17: 35,114,859 (GRCm39) S215P possibly damaging Het
Zfp346 T C 13: 55,260,915 (GRCm39) M81T probably benign Het
Zfp800 T C 6: 28,244,512 (GRCm39) D151G probably null Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111,828,704 (GRCm39) missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111,839,342 (GRCm39) missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111,847,910 (GRCm39) splice site probably null
IGL01681:Pdpr APN 8 111,859,568 (GRCm39) missense probably damaging 1.00
IGL01785:Pdpr APN 8 111,856,288 (GRCm39) missense probably damaging 0.98
IGL02115:Pdpr APN 8 111,830,630 (GRCm39) missense probably damaging 1.00
IGL02292:Pdpr APN 8 111,852,312 (GRCm39) missense probably damaging 1.00
IGL02749:Pdpr APN 8 111,844,722 (GRCm39) missense probably benign 0.01
IGL03296:Pdpr APN 8 111,841,430 (GRCm39) missense probably damaging 1.00
R0730:Pdpr UTSW 8 111,852,387 (GRCm39) critical splice donor site probably null
R1510:Pdpr UTSW 8 111,851,107 (GRCm39) splice site probably benign
R1837:Pdpr UTSW 8 111,861,366 (GRCm39) missense probably damaging 1.00
R1838:Pdpr UTSW 8 111,861,366 (GRCm39) missense probably damaging 1.00
R2144:Pdpr UTSW 8 111,844,668 (GRCm39) missense probably damaging 0.97
R4214:Pdpr UTSW 8 111,856,212 (GRCm39) intron probably benign
R4812:Pdpr UTSW 8 111,843,349 (GRCm39) missense probably benign 0.00
R4863:Pdpr UTSW 8 111,828,583 (GRCm39) missense probably benign 0.01
R4998:Pdpr UTSW 8 111,841,400 (GRCm39) missense probably damaging 1.00
R5579:Pdpr UTSW 8 111,850,448 (GRCm39) missense probably damaging 1.00
R5739:Pdpr UTSW 8 111,861,252 (GRCm39) missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111,828,532 (GRCm39) nonsense probably null
R6785:Pdpr UTSW 8 111,851,243 (GRCm39) missense probably benign 0.00
R6889:Pdpr UTSW 8 111,851,245 (GRCm39) critical splice donor site probably null
R7397:Pdpr UTSW 8 111,839,385 (GRCm39) missense possibly damaging 0.73
R7543:Pdpr UTSW 8 111,859,520 (GRCm39) missense probably damaging 1.00
R7634:Pdpr UTSW 8 111,852,317 (GRCm39) missense probably damaging 1.00
R8683:Pdpr UTSW 8 111,850,492 (GRCm39) missense probably damaging 1.00
R8794:Pdpr UTSW 8 111,852,240 (GRCm39) missense possibly damaging 0.53
R8833:Pdpr UTSW 8 111,852,312 (GRCm39) missense probably damaging 1.00
R9283:Pdpr UTSW 8 111,856,268 (GRCm39) missense possibly damaging 0.62
R9487:Pdpr UTSW 8 111,852,925 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCTTAACCAGTAAGCCTTC -3'
(R):5'- AGCTCTGGATTACCCACTCC -3'

Sequencing Primer
(F):5'- ACCAGGTTGGCTTAGAACTC -3'
(R):5'- GCTCTGGATTACCCACTCCAAATAAG -3'
Posted On 2016-11-09