Incidental Mutation 'R5665:Myo5a'
ID 444348
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
MMRRC Submission 043308-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5665 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 74978297-75130970 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75051463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000136731] [ENSMUST00000155282] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably null
Transcript: ENSMUST00000123128
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123128
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably null
Transcript: ENSMUST00000136731
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136731
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142181
Predicted Effect probably null
Transcript: ENSMUST00000155282
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155282
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acaca G T 11: 84,136,120 (GRCm39) E492* probably null Het
Acp7 T A 7: 28,315,968 (GRCm39) K206M probably benign Het
Agbl1 T A 7: 76,239,251 (GRCm39) F584I probably damaging Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Arhgef40 A G 14: 52,238,357 (GRCm39) I1279V possibly damaging Het
Arl14 A C 3: 69,130,371 (GRCm39) T173P probably damaging Het
Asap1 A G 15: 64,184,302 (GRCm39) S44P probably damaging Het
Btbd7 C A 12: 102,751,456 (GRCm39) A1103S probably benign Het
Capn10 T A 1: 92,865,653 (GRCm39) probably null Het
Capn7 T C 14: 31,091,759 (GRCm39) F719L probably benign Het
Casp7 G A 19: 56,429,414 (GRCm39) D267N probably benign Het
Ccdc13 C A 9: 121,643,356 (GRCm39) K348N probably damaging Het
Chchd1 T C 14: 20,753,178 (GRCm39) F13L probably benign Het
Clcn6 T A 4: 148,099,018 (GRCm39) M442L possibly damaging Het
Col6a3 T C 1: 90,755,602 (GRCm39) E229G probably benign Het
Cyb5r3 A G 15: 83,038,755 (GRCm39) F278S probably damaging Het
Dhx16 C T 17: 36,201,978 (GRCm39) Q1002* probably null Het
Dppa4 T C 16: 48,111,378 (GRCm39) L121P probably benign Het
Dpyd A G 3: 118,710,741 (GRCm39) E383G probably damaging Het
Eif4g3 A G 4: 137,853,900 (GRCm39) T489A probably benign Het
Elovl1 G T 4: 118,288,832 (GRCm39) V174L probably damaging Het
Elp3 T C 14: 65,788,851 (GRCm39) K392E possibly damaging Het
Fancd2os C A 6: 113,574,985 (GRCm39) W7L probably damaging Het
Fchsd2 A G 7: 100,759,991 (GRCm39) T23A possibly damaging Het
Gabrp C G 11: 33,504,308 (GRCm39) A336P possibly damaging Het
Gcm2 T A 13: 41,263,387 (GRCm39) Y15F possibly damaging Het
Gpr132 G A 12: 112,816,416 (GRCm39) R137C probably damaging Het
Herc1 A G 9: 66,372,717 (GRCm39) E3091G probably damaging Het
Homer1 A T 13: 93,492,610 (GRCm39) M184L probably benign Het
Izumo1r T C 9: 14,812,145 (GRCm39) E117G probably damaging Het
Kcnt1 C T 2: 25,791,921 (GRCm39) Q590* probably null Het
Lama1 G T 17: 68,077,982 (GRCm39) C1139F probably damaging Het
Med29 C T 7: 28,086,239 (GRCm39) A190T probably benign Het
Muc4 T C 16: 32,569,600 (GRCm39) V220A probably benign Het
Mxra8 G T 4: 155,927,378 (GRCm39) V388L probably benign Het
Myrip A G 9: 120,290,499 (GRCm39) Y706C probably damaging Het
Nphp4 T C 4: 152,590,942 (GRCm39) V313A probably benign Het
Oga A C 19: 45,765,436 (GRCm39) S124A probably benign Het
Olfm2 T G 9: 20,579,840 (GRCm39) probably null Het
Or10ag52 T A 2: 87,044,072 (GRCm39) S279T probably benign Het
Or10x4 T C 1: 174,218,941 (GRCm39) F102S probably damaging Het
Pcdh15 C T 10: 74,462,620 (GRCm39) P1398L probably damaging Het
Pdpr A G 8: 111,841,443 (GRCm39) E225G possibly damaging Het
Pigs C A 11: 78,219,595 (GRCm39) probably null Het
Pkhd1 T A 1: 20,658,755 (GRCm39) T159S probably damaging Het
Plk4 A G 3: 40,768,021 (GRCm39) T87A possibly damaging Het
Plxna4 T C 6: 32,192,657 (GRCm39) Y768C probably damaging Het
Prl3d3 T A 13: 27,343,064 (GRCm39) probably null Het
Pygb T C 2: 150,662,808 (GRCm39) probably null Het
Rnf114 T C 2: 167,352,854 (GRCm39) I118T possibly damaging Het
Sbno2 A G 10: 79,894,287 (GRCm39) L1099P probably benign Het
Scaper T C 9: 55,714,916 (GRCm39) K791E probably damaging Het
Serping1 T C 2: 84,601,889 (GRCm39) T194A probably damaging Het
Slc12a9 A G 5: 137,319,665 (GRCm39) S617P possibly damaging Het
Slk G A 19: 47,624,896 (GRCm39) R1039H probably damaging Het
Sntb1 T A 15: 55,655,535 (GRCm39) E227V probably benign Het
Sostdc1 C A 12: 36,364,407 (GRCm39) P39T probably benign Het
Spred1 C T 2: 116,983,486 (GRCm39) R16* probably null Het
Srpk2 A G 5: 23,723,475 (GRCm39) I547T probably damaging Het
Stt3a A G 9: 36,670,610 (GRCm39) Y54H probably damaging Het
Stt3b A T 9: 115,095,215 (GRCm39) L272H probably damaging Het
Syne2 T A 12: 76,154,991 (GRCm39) probably null Het
Uso1 A T 5: 92,346,196 (GRCm39) E793V possibly damaging Het
Usp15 A T 10: 122,966,892 (GRCm39) L476* probably null Het
Vmn1r189 T C 13: 22,286,336 (GRCm39) Y167C probably damaging Het
Vmn2r24 A G 6: 123,763,938 (GRCm39) T272A possibly damaging Het
Vps13a A T 19: 16,646,054 (GRCm39) H1994Q probably damaging Het
Zbtb10 T C 3: 9,330,252 (GRCm39) S537P probably damaging Het
Zbtb12 T C 17: 35,114,859 (GRCm39) S215P possibly damaging Het
Zfp346 T C 13: 55,260,915 (GRCm39) M81T probably benign Het
Zfp800 T C 6: 28,244,512 (GRCm39) D151G probably null Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75,068,779 (GRCm39) nonsense probably null
IGL00547:Myo5a APN 9 75,048,735 (GRCm39) missense probably benign 0.00
IGL00788:Myo5a APN 9 75,076,241 (GRCm39) missense probably benign 0.15
IGL01327:Myo5a APN 9 75,094,820 (GRCm39) splice site probably benign
IGL01687:Myo5a APN 9 75,063,531 (GRCm39) missense probably benign 0.12
IGL01886:Myo5a APN 9 75,076,372 (GRCm39) splice site probably benign
IGL01945:Myo5a APN 9 75,047,953 (GRCm39) missense probably damaging 1.00
IGL02127:Myo5a APN 9 75,120,263 (GRCm39) missense probably benign 0.12
IGL02137:Myo5a APN 9 75,068,817 (GRCm39) splice site probably null
IGL02183:Myo5a APN 9 75,074,518 (GRCm39) splice site probably benign
IGL02427:Myo5a APN 9 75,083,900 (GRCm39) splice site probably benign
IGL02490:Myo5a APN 9 75,043,737 (GRCm39) missense probably damaging 1.00
IGL02574:Myo5a APN 9 75,118,429 (GRCm39) missense probably benign 0.00
IGL02886:Myo5a APN 9 75,059,169 (GRCm39) splice site probably benign
IGL02961:Myo5a APN 9 75,122,402 (GRCm39) missense probably benign 0.04
IGL03090:Myo5a APN 9 75,028,115 (GRCm39) missense probably damaging 1.00
IGL03119:Myo5a APN 9 75,081,297 (GRCm39) missense probably benign 0.01
IGL03237:Myo5a APN 9 75,037,276 (GRCm39) missense probably damaging 1.00
IGL03296:Myo5a APN 9 75,023,484 (GRCm39) missense probably damaging 1.00
naoki UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
new_gray UTSW 9 0 () missense
nut UTSW 9 0 () splice donor site
silver_decerebrate UTSW 9 75,071,477 (GRCm39) missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75,118,408 (GRCm39) missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75,037,423 (GRCm39) splice site probably benign
IGL03050:Myo5a UTSW 9 75,054,191 (GRCm39) splice site probably null
PIT4403001:Myo5a UTSW 9 75,124,805 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0091:Myo5a UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
R0142:Myo5a UTSW 9 75,067,856 (GRCm39) missense probably benign 0.01
R0243:Myo5a UTSW 9 75,093,405 (GRCm39) critical splice donor site probably null
R0395:Myo5a UTSW 9 75,101,259 (GRCm39) missense probably benign 0.39
R0427:Myo5a UTSW 9 75,081,478 (GRCm39) missense probably benign 0.00
R0545:Myo5a UTSW 9 75,074,319 (GRCm39) missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75,087,394 (GRCm39) missense probably benign 0.00
R0601:Myo5a UTSW 9 75,081,297 (GRCm39) missense probably benign 0.01
R1457:Myo5a UTSW 9 75,120,347 (GRCm39) missense probably damaging 0.99
R1510:Myo5a UTSW 9 75,078,833 (GRCm39) missense probably benign
R1548:Myo5a UTSW 9 75,079,028 (GRCm39) missense probably damaging 1.00
R1759:Myo5a UTSW 9 75,089,275 (GRCm39) missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75,023,489 (GRCm39) missense probably damaging 1.00
R1960:Myo5a UTSW 9 75,055,139 (GRCm39) missense probably damaging 1.00
R2050:Myo5a UTSW 9 75,054,156 (GRCm39) missense probably benign 0.01
R2070:Myo5a UTSW 9 75,089,266 (GRCm39) missense probably benign 0.03
R2075:Myo5a UTSW 9 75,097,200 (GRCm39) missense probably benign 0.01
R2148:Myo5a UTSW 9 75,087,429 (GRCm39) missense probably damaging 1.00
R2201:Myo5a UTSW 9 75,125,225 (GRCm39) missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75,111,083 (GRCm39) missense probably damaging 1.00
R2357:Myo5a UTSW 9 75,108,647 (GRCm39) missense probably damaging 0.99
R2392:Myo5a UTSW 9 75,116,521 (GRCm39) missense probably benign 0.02
R2432:Myo5a UTSW 9 75,120,155 (GRCm39) missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75,059,179 (GRCm39) missense probably damaging 1.00
R2568:Myo5a UTSW 9 75,030,322 (GRCm39) missense probably damaging 1.00
R2932:Myo5a UTSW 9 75,103,418 (GRCm39) missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75,023,484 (GRCm39) missense probably damaging 1.00
R4231:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75,051,453 (GRCm39) missense probably benign
R4321:Myo5a UTSW 9 75,124,812 (GRCm39) missense probably damaging 0.99
R4450:Myo5a UTSW 9 75,074,458 (GRCm39) missense probably benign 0.00
R4573:Myo5a UTSW 9 75,108,579 (GRCm39) splice site probably null
R4577:Myo5a UTSW 9 75,124,827 (GRCm39) missense probably damaging 1.00
R4601:Myo5a UTSW 9 75,043,670 (GRCm39) missense probably damaging 1.00
R4690:Myo5a UTSW 9 75,061,105 (GRCm39) missense probably damaging 0.99
R4691:Myo5a UTSW 9 75,087,438 (GRCm39) missense probably damaging 0.99
R4764:Myo5a UTSW 9 75,023,618 (GRCm39) intron probably benign
R4767:Myo5a UTSW 9 75,051,358 (GRCm39) missense probably damaging 0.99
R4811:Myo5a UTSW 9 75,048,825 (GRCm39) critical splice donor site probably null
R4829:Myo5a UTSW 9 75,043,689 (GRCm39) missense probably damaging 1.00
R4863:Myo5a UTSW 9 75,124,789 (GRCm39) missense probably damaging 1.00
R4902:Myo5a UTSW 9 75,081,360 (GRCm39) missense probably benign
R4947:Myo5a UTSW 9 75,030,330 (GRCm39) missense probably damaging 1.00
R5074:Myo5a UTSW 9 75,081,438 (GRCm39) missense probably benign
R5095:Myo5a UTSW 9 75,091,671 (GRCm39) nonsense probably null
R5095:Myo5a UTSW 9 75,059,302 (GRCm39) missense probably damaging 1.00
R5254:Myo5a UTSW 9 75,037,402 (GRCm39) missense probably damaging 1.00
R5267:Myo5a UTSW 9 75,059,292 (GRCm39) missense probably damaging 1.00
R5419:Myo5a UTSW 9 75,055,179 (GRCm39) missense probably damaging 1.00
R5514:Myo5a UTSW 9 75,061,048 (GRCm39) missense probably damaging 1.00
R5629:Myo5a UTSW 9 75,111,127 (GRCm39) missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75,079,001 (GRCm39) missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75,074,488 (GRCm39) missense probably benign 0.02
R5719:Myo5a UTSW 9 75,059,213 (GRCm39) missense probably damaging 1.00
R5964:Myo5a UTSW 9 75,111,115 (GRCm39) missense probably benign 0.09
R6014:Myo5a UTSW 9 75,074,489 (GRCm39) nonsense probably null
R6344:Myo5a UTSW 9 75,067,791 (GRCm39) missense probably benign 0.09
R6345:Myo5a UTSW 9 75,097,195 (GRCm39) missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75,054,249 (GRCm39) missense probably damaging 0.98
R6712:Myo5a UTSW 9 75,120,182 (GRCm39) missense probably benign 0.12
R6838:Myo5a UTSW 9 75,061,165 (GRCm39) critical splice donor site probably null
R6866:Myo5a UTSW 9 75,047,970 (GRCm39) missense probably damaging 1.00
R6876:Myo5a UTSW 9 75,067,772 (GRCm39) missense probably benign 0.04
R7108:Myo5a UTSW 9 75,037,274 (GRCm39) missense probably damaging 1.00
R7159:Myo5a UTSW 9 75,078,845 (GRCm39) missense probably benign 0.07
R7164:Myo5a UTSW 9 75,087,435 (GRCm39) missense probably benign 0.00
R7219:Myo5a UTSW 9 75,028,052 (GRCm39) missense probably damaging 1.00
R7497:Myo5a UTSW 9 75,104,983 (GRCm39) missense
R7620:Myo5a UTSW 9 75,071,418 (GRCm39) missense probably benign 0.41
R7719:Myo5a UTSW 9 75,051,366 (GRCm39) missense probably benign 0.01
R7810:Myo5a UTSW 9 75,076,292 (GRCm39) missense probably benign
R7810:Myo5a UTSW 9 75,067,747 (GRCm39) missense probably benign 0.09
R7866:Myo5a UTSW 9 75,111,034 (GRCm39) missense probably damaging 1.00
R7939:Myo5a UTSW 9 75,097,182 (GRCm39) missense
R8050:Myo5a UTSW 9 75,089,228 (GRCm39) missense probably damaging 0.99
R8061:Myo5a UTSW 9 75,030,239 (GRCm39) nonsense probably null
R8326:Myo5a UTSW 9 75,125,271 (GRCm39) missense probably damaging 0.98
R8529:Myo5a UTSW 9 75,120,154 (GRCm39) missense probably benign 0.02
R8824:Myo5a UTSW 9 75,074,328 (GRCm39) missense probably damaging 1.00
R8858:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9040:Myo5a UTSW 9 75,081,341 (GRCm39) missense probably benign 0.07
R9092:Myo5a UTSW 9 75,054,414 (GRCm39) critical splice donor site probably null
R9249:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75,087,312 (GRCm39) missense probably benign 0.37
R9366:Myo5a UTSW 9 75,124,800 (GRCm39) missense probably damaging 0.98
R9410:Myo5a UTSW 9 75,023,496 (GRCm39) missense probably damaging 0.98
R9644:Myo5a UTSW 9 75,043,631 (GRCm39) missense probably damaging 1.00
R9649:Myo5a UTSW 9 75,099,726 (GRCm39) missense
R9748:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9766:Myo5a UTSW 9 75,078,914 (GRCm39) missense probably damaging 0.99
X0010:Myo5a UTSW 9 75,093,187 (GRCm39) missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75,093,318 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CTATGAATGTACTATGCACATCTGG -3'
(R):5'- AGTAGACCTGAATTTGCCCC -3'

Sequencing Primer
(F):5'- TGCACATCTGGCAATATTCAAG -3'
(R):5'- CCCCCAAAATCATGTTCAAAAAG -3'
Posted On 2016-11-09