Incidental Mutation 'H8786:Parp11'
ID44435
Institutional Source Beutler Lab
Gene Symbol Parp11
Ensembl Gene ENSMUSG00000037997
Gene Namepoly (ADP-ribose) polymerase family, member 11
Synonyms5330431N24Rik, HIN1L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location127446840-127494261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127471635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 72 (T72A)
Ref Sequence ENSEMBL: ENSMUSP00000107814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039680] [ENSMUST00000112191] [ENSMUST00000112193] [ENSMUST00000112195] [ENSMUST00000144115]
Predicted Effect probably damaging
Transcript: ENSMUST00000039680
AA Change: T72A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036127
Gene: ENSMUSG00000037997
AA Change: T72A

DomainStartEndE-ValueType
Pfam:WWE 25 99 1.4e-18 PFAM
Pfam:PARP 129 331 4.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112191
SMART Domains Protein: ENSMUSP00000107810
Gene: ENSMUSG00000037997

DomainStartEndE-ValueType
Pfam:PARP 46 248 4e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112193
AA Change: T72A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107812
Gene: ENSMUSG00000037997
AA Change: T72A

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112195
AA Change: T72A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107814
Gene: ENSMUSG00000037997
AA Change: T72A

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136945
Predicted Effect probably benign
Transcript: ENSMUST00000144115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201717
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired male fertility and teratozoospermia associated with sperm head malformations and nuclear envelope defects during the nuclear reshaping process of spermatid elongation and condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Parp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Parp11 APN 6 127471563 nonsense probably null
IGL01548:Parp11 APN 6 127491599 missense probably damaging 1.00
IGL01638:Parp11 APN 6 127491529 missense probably benign 0.13
IGL01688:Parp11 APN 6 127471606 missense probably benign 0.00
IGL03201:Parp11 APN 6 127490018 missense possibly damaging 0.80
IGL03297:Parp11 APN 6 127490082 splice site probably benign
R1514:Parp11 UTSW 6 127474293 missense possibly damaging 0.89
R1817:Parp11 UTSW 6 127490045 missense probably damaging 1.00
R1868:Parp11 UTSW 6 127470777 missense probably damaging 1.00
R1942:Parp11 UTSW 6 127470700 critical splice acceptor site probably null
R2011:Parp11 UTSW 6 127477891 missense probably benign 0.02
R4483:Parp11 UTSW 6 127471605 missense probably benign
R4507:Parp11 UTSW 6 127474283 missense probably damaging 1.00
R4593:Parp11 UTSW 6 127474299 missense probably benign 0.03
R5024:Parp11 UTSW 6 127471636 missense probably damaging 1.00
R5371:Parp11 UTSW 6 127470792 missense probably damaging 1.00
R6608:Parp11 UTSW 6 127477848 missense possibly damaging 0.93
R7606:Parp11 UTSW 6 127470760 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCGGAGTCGTTAATAACTTCCCAC -3'
(R):5'- TGCTCAAGAGTTGACAGTGCAGG -3'

Sequencing Primer
(F):5'- TTCCCACGAGCAGTCTTGG -3'
(R):5'- AGTTGACAGTGCAGGTTTGATTG -3'
Posted On2013-06-11