Incidental Mutation 'R5665:Sbno2'
ID 444356
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Name strawberry notch 2
Synonyms Stno
MMRRC Submission 043308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5665 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80056992-80105571 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80058453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1099 (L1099P)
Ref Sequence ENSEMBL: ENSMUSP00000151590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]
AlphaFold Q7TNB8
Predicted Effect probably benign
Transcript: ENSMUST00000042771
AA Change: L1099P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: L1099P

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097227
SMART Domains Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:GSHPx 97 204 6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105372
SMART Domains Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:GSHPx 41 148 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154095
Predicted Effect probably benign
Transcript: ENSMUST00000183037
SMART Domains Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
Pfam:GSHPx 1 108 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217876
Predicted Effect probably benign
Transcript: ENSMUST00000217972
Predicted Effect probably benign
Transcript: ENSMUST00000218630
AA Change: L1098P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219260
AA Change: L1099P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Uso1 A T 5: 92,198,337 E793V possibly damaging Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
Narcissus UTSW 10 80062208 missense probably damaging 1.00
psychopomp UTSW 10 80060016 missense probably damaging 0.99
Unsafe UTSW 10 80060215 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7746:Sbno2 UTSW 10 80058874 missense probably damaging 0.99
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8055:Sbno2 UTSW 10 80069431 missense possibly damaging 0.81
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
R8725:Sbno2 UTSW 10 80075256 missense probably benign 0.09
R8727:Sbno2 UTSW 10 80075256 missense probably benign 0.09
R8840:Sbno2 UTSW 10 80057526 missense probably damaging 0.97
R8932:Sbno2 UTSW 10 80062208 missense probably damaging 1.00
R8954:Sbno2 UTSW 10 80057962 missense probably damaging 1.00
R9003:Sbno2 UTSW 10 80060215 missense probably damaging 1.00
R9034:Sbno2 UTSW 10 80062757 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTGACTGCAGTGCTCCAAG -3'
(R):5'- AAGGTCCCTATGATGGCTTCTAC -3'

Sequencing Primer
(F):5'- ACTGCAGTGCTCCAAGGACAG -3'
(R):5'- TACAAGGTGAGTTGTCCCAC -3'
Posted On 2016-11-09