Incidental Mutation 'H8786:Npas1'
ID44436
Institutional Source Beutler Lab
Gene Symbol Npas1
Ensembl Gene ENSMUSG00000001988
Gene Nameneuronal PAS domain protein 1
SynonymsbHLHe11, MOP5
Accession Numbers

Genbank: NM_008718; MGI: 109205

Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16455721-16477728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16461350 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 351 (I351T)
Ref Sequence ENSEMBL: ENSMUSP00000147412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002053] [ENSMUST00000210748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002053
AA Change: I351T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002053
Gene: ENSMUSG00000001988
AA Change: I351T

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
HLH 51 106 1.44e-6 SMART
low complexity region 109 128 N/A INTRINSIC
PAS 137 203 1.09e-11 SMART
low complexity region 212 223 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
PAS 294 360 5.32e-6 SMART
PAC 366 409 5.64e0 SMART
low complexity region 428 443 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210748
AA Change: I351T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211103
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. Studies of a related mouse gene suggest that it functions in neurons. The exact function of this gene is unclear, but it may play protective or modulatory roles during late embryogenesis and postnatal development. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Npas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Npas1 APN 7 16463322 missense probably benign 0.05
IGL01627:Npas1 APN 7 16465186 missense probably damaging 1.00
IGL02812:Npas1 APN 7 16456116 missense probably damaging 1.00
IGL03141:Npas1 APN 7 16465138 missense probably damaging 1.00
D4043:Npas1 UTSW 7 16463244 splice site probably null
R0218:Npas1 UTSW 7 16461893 missense probably benign 0.39
R1736:Npas1 UTSW 7 16474616 missense probably benign 0.24
R1795:Npas1 UTSW 7 16474800 missense probably damaging 1.00
R2093:Npas1 UTSW 7 16459277 missense probably benign
R2570:Npas1 UTSW 7 16474703 missense probably damaging 1.00
R4057:Npas1 UTSW 7 16474787 missense probably damaging 1.00
R4385:Npas1 UTSW 7 16459185 critical splice donor site probably null
R5937:Npas1 UTSW 7 16463262 missense probably benign 0.15
R6456:Npas1 UTSW 7 16461926 missense probably benign 0.44
R7195:Npas1 UTSW 7 16474808 missense probably damaging 1.00
R7544:Npas1 UTSW 7 16460974 intron probably null
Predicted Primers PCR Primer
(F):5'- AGAGACCCCTCTTACCCGGCTTAC -3'
(R):5'- TGAAGCCAGCTCTGCTGTCTCC -3'

Sequencing Primer
(F):5'- AGCCACTGCTCAGCCTC -3'
(R):5'- GTCTCCTGTCACCCAATGTC -3'
Posted On2013-06-11