Incidental Mutation 'R5665:Casp7'
ID 444389
Institutional Source Beutler Lab
Gene Symbol Casp7
Ensembl Gene ENSMUSG00000025076
Gene Name caspase 7
Synonyms ICE-IAP3, CMH-1, caspase-7, Mch3
MMRRC Submission 043308-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5665 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 56385561-56430776 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 56429414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 267 (D267N)
Ref Sequence ENSEMBL: ENSMUSP00000026062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026062]
AlphaFold P97864
Predicted Effect probably benign
Transcript: ENSMUST00000026062
AA Change: D267N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026062
Gene: ENSMUSG00000025076
AA Change: D267N

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
CASc 59 303 2.2e-135 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation have normal appearance, organ morphology and lymphoid development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acaca G T 11: 84,136,120 (GRCm39) E492* probably null Het
Acp7 T A 7: 28,315,968 (GRCm39) K206M probably benign Het
Agbl1 T A 7: 76,239,251 (GRCm39) F584I probably damaging Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Arhgef40 A G 14: 52,238,357 (GRCm39) I1279V possibly damaging Het
Arl14 A C 3: 69,130,371 (GRCm39) T173P probably damaging Het
Asap1 A G 15: 64,184,302 (GRCm39) S44P probably damaging Het
Btbd7 C A 12: 102,751,456 (GRCm39) A1103S probably benign Het
Capn10 T A 1: 92,865,653 (GRCm39) probably null Het
Capn7 T C 14: 31,091,759 (GRCm39) F719L probably benign Het
Ccdc13 C A 9: 121,643,356 (GRCm39) K348N probably damaging Het
Chchd1 T C 14: 20,753,178 (GRCm39) F13L probably benign Het
Clcn6 T A 4: 148,099,018 (GRCm39) M442L possibly damaging Het
Col6a3 T C 1: 90,755,602 (GRCm39) E229G probably benign Het
Cyb5r3 A G 15: 83,038,755 (GRCm39) F278S probably damaging Het
Dhx16 C T 17: 36,201,978 (GRCm39) Q1002* probably null Het
Dppa4 T C 16: 48,111,378 (GRCm39) L121P probably benign Het
Dpyd A G 3: 118,710,741 (GRCm39) E383G probably damaging Het
Eif4g3 A G 4: 137,853,900 (GRCm39) T489A probably benign Het
Elovl1 G T 4: 118,288,832 (GRCm39) V174L probably damaging Het
Elp3 T C 14: 65,788,851 (GRCm39) K392E possibly damaging Het
Fancd2os C A 6: 113,574,985 (GRCm39) W7L probably damaging Het
Fchsd2 A G 7: 100,759,991 (GRCm39) T23A possibly damaging Het
Gabrp C G 11: 33,504,308 (GRCm39) A336P possibly damaging Het
Gcm2 T A 13: 41,263,387 (GRCm39) Y15F possibly damaging Het
Gpr132 G A 12: 112,816,416 (GRCm39) R137C probably damaging Het
Herc1 A G 9: 66,372,717 (GRCm39) E3091G probably damaging Het
Homer1 A T 13: 93,492,610 (GRCm39) M184L probably benign Het
Izumo1r T C 9: 14,812,145 (GRCm39) E117G probably damaging Het
Kcnt1 C T 2: 25,791,921 (GRCm39) Q590* probably null Het
Lama1 G T 17: 68,077,982 (GRCm39) C1139F probably damaging Het
Med29 C T 7: 28,086,239 (GRCm39) A190T probably benign Het
Muc4 T C 16: 32,569,600 (GRCm39) V220A probably benign Het
Mxra8 G T 4: 155,927,378 (GRCm39) V388L probably benign Het
Myo5a T C 9: 75,051,463 (GRCm39) probably null Het
Myrip A G 9: 120,290,499 (GRCm39) Y706C probably damaging Het
Nphp4 T C 4: 152,590,942 (GRCm39) V313A probably benign Het
Oga A C 19: 45,765,436 (GRCm39) S124A probably benign Het
Olfm2 T G 9: 20,579,840 (GRCm39) probably null Het
Or10ag52 T A 2: 87,044,072 (GRCm39) S279T probably benign Het
Or10x4 T C 1: 174,218,941 (GRCm39) F102S probably damaging Het
Pcdh15 C T 10: 74,462,620 (GRCm39) P1398L probably damaging Het
Pdpr A G 8: 111,841,443 (GRCm39) E225G possibly damaging Het
Pigs C A 11: 78,219,595 (GRCm39) probably null Het
Pkhd1 T A 1: 20,658,755 (GRCm39) T159S probably damaging Het
Plk4 A G 3: 40,768,021 (GRCm39) T87A possibly damaging Het
Plxna4 T C 6: 32,192,657 (GRCm39) Y768C probably damaging Het
Prl3d3 T A 13: 27,343,064 (GRCm39) probably null Het
Pygb T C 2: 150,662,808 (GRCm39) probably null Het
Rnf114 T C 2: 167,352,854 (GRCm39) I118T possibly damaging Het
Sbno2 A G 10: 79,894,287 (GRCm39) L1099P probably benign Het
Scaper T C 9: 55,714,916 (GRCm39) K791E probably damaging Het
Serping1 T C 2: 84,601,889 (GRCm39) T194A probably damaging Het
Slc12a9 A G 5: 137,319,665 (GRCm39) S617P possibly damaging Het
Slk G A 19: 47,624,896 (GRCm39) R1039H probably damaging Het
Sntb1 T A 15: 55,655,535 (GRCm39) E227V probably benign Het
Sostdc1 C A 12: 36,364,407 (GRCm39) P39T probably benign Het
Spred1 C T 2: 116,983,486 (GRCm39) R16* probably null Het
Srpk2 A G 5: 23,723,475 (GRCm39) I547T probably damaging Het
Stt3a A G 9: 36,670,610 (GRCm39) Y54H probably damaging Het
Stt3b A T 9: 115,095,215 (GRCm39) L272H probably damaging Het
Syne2 T A 12: 76,154,991 (GRCm39) probably null Het
Uso1 A T 5: 92,346,196 (GRCm39) E793V possibly damaging Het
Usp15 A T 10: 122,966,892 (GRCm39) L476* probably null Het
Vmn1r189 T C 13: 22,286,336 (GRCm39) Y167C probably damaging Het
Vmn2r24 A G 6: 123,763,938 (GRCm39) T272A possibly damaging Het
Vps13a A T 19: 16,646,054 (GRCm39) H1994Q probably damaging Het
Zbtb10 T C 3: 9,330,252 (GRCm39) S537P probably damaging Het
Zbtb12 T C 17: 35,114,859 (GRCm39) S215P possibly damaging Het
Zfp346 T C 13: 55,260,915 (GRCm39) M81T probably benign Het
Zfp800 T C 6: 28,244,512 (GRCm39) D151G probably null Het
Other mutations in Casp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Casp7 APN 19 56,425,177 (GRCm39) missense probably benign 0.00
IGL01338:Casp7 APN 19 56,392,896 (GRCm39) missense probably benign
IGL02831:Casp7 APN 19 56,392,855 (GRCm39) missense probably benign 0.01
IGL02886:Casp7 APN 19 56,421,775 (GRCm39) missense probably damaging 1.00
R1558:Casp7 UTSW 19 56,421,684 (GRCm39) nonsense probably null
R2026:Casp7 UTSW 19 56,424,830 (GRCm39) missense probably damaging 1.00
R5445:Casp7 UTSW 19 56,421,770 (GRCm39) splice site probably null
R5765:Casp7 UTSW 19 56,422,315 (GRCm39) missense possibly damaging 0.87
R6207:Casp7 UTSW 19 56,429,452 (GRCm39) missense possibly damaging 0.53
R6893:Casp7 UTSW 19 56,421,741 (GRCm39) missense probably damaging 1.00
R7261:Casp7 UTSW 19 56,424,765 (GRCm39) missense probably benign 0.00
R7271:Casp7 UTSW 19 56,424,793 (GRCm39) missense probably damaging 1.00
R8331:Casp7 UTSW 19 56,429,397 (GRCm39) missense probably damaging 1.00
R9498:Casp7 UTSW 19 56,424,767 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCTCAGGGTTGGCTAATG -3'
(R):5'- TTCTGGATATTTTGAGAGCATCGGAAC -3'

Sequencing Primer
(F):5'- CAGGGTTGGCTAATGGATCTCCC -3'
(R):5'- CTTTGGTGAGCATGGACA -3'
Posted On 2016-11-09