Incidental Mutation 'R5666:Lpin3'
ID 444402
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Name lipin 3
Synonyms 9130206L11Rik
MMRRC Submission 043309-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5666 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 160722590-160747920 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160739250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
AlphaFold Q99PI4
Predicted Effect probably benign
Transcript: ENSMUST00000040872
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109455
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: T353A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Abce1 C A 8: 80,416,906 (GRCm39) E368D probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Bop1 T C 15: 76,338,433 (GRCm39) E503G probably benign Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Chd3 T C 11: 69,244,177 (GRCm39) E1202G possibly damaging Het
Cmya5 T C 13: 93,182,457 (GRCm39) I3568V possibly damaging Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Cpxm2 C T 7: 131,656,625 (GRCm39) E546K probably benign Het
Cyp2j5 C T 4: 96,546,930 (GRCm39) V195I probably benign Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
E2f1 T A 2: 154,411,101 (GRCm39) probably benign Het
Ephb3 A G 16: 21,041,241 (GRCm39) N732S probably benign Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Foxm1 C T 6: 128,350,130 (GRCm39) S339L possibly damaging Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Gfpt1 A T 6: 87,030,795 (GRCm39) I60F possibly damaging Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Hs2st1 A T 3: 144,275,554 (GRCm39) V22E probably damaging Het
Hspa9 T C 18: 35,087,300 (GRCm39) I2V probably null Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Myh1 T A 11: 67,112,178 (GRCm39) I1744N probably benign Het
Nadsyn1 C T 7: 143,361,168 (GRCm39) G335S probably damaging Het
Ndc1 T C 4: 107,246,723 (GRCm39) V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nmt1 C T 11: 102,949,041 (GRCm39) R299* probably null Het
Or1j20 T A 2: 36,760,401 (GRCm39) D274E probably benign Het
Or2y8 A C 11: 52,035,525 (GRCm39) Y277* probably null Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Padi2 G T 4: 140,676,542 (GRCm39) R560L possibly damaging Het
Palmd T C 3: 116,717,750 (GRCm39) N249S possibly damaging Het
Pde1c A C 6: 56,103,842 (GRCm39) probably null Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pla2g2d T A 4: 138,507,591 (GRCm39) C82S probably damaging Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Slc7a4 A G 16: 17,393,815 (GRCm39) probably benign Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Sstr2 T A 11: 113,515,539 (GRCm39) W153R probably damaging Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tas2r130 T C 6: 131,607,342 (GRCm39) N151S possibly damaging Het
Tex52 T C 6: 128,352,518 (GRCm39) S13P probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160,735,918 (GRCm39) missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160,745,649 (GRCm39) missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160,739,047 (GRCm39) missense probably benign 0.02
IGL02124:Lpin3 APN 2 160,737,753 (GRCm39) critical splice donor site probably null
IGL02272:Lpin3 APN 2 160,743,581 (GRCm39) missense probably benign 0.15
IGL02314:Lpin3 APN 2 160,740,638 (GRCm39) nonsense probably null
IGL02374:Lpin3 APN 2 160,737,758 (GRCm39) splice site probably benign
IGL02554:Lpin3 APN 2 160,738,707 (GRCm39) missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160,746,975 (GRCm39) missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160,740,540 (GRCm39) splice site probably benign
IGL03143:Lpin3 APN 2 160,745,518 (GRCm39) splice site probably benign
R0100:Lpin3 UTSW 2 160,747,260 (GRCm39) missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160,747,260 (GRCm39) missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160,740,601 (GRCm39) missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160,740,601 (GRCm39) missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160,747,225 (GRCm39) missense probably benign
R0330:Lpin3 UTSW 2 160,747,225 (GRCm39) missense probably benign
R0570:Lpin3 UTSW 2 160,745,944 (GRCm39) splice site probably benign
R0633:Lpin3 UTSW 2 160,745,894 (GRCm39) missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160,735,999 (GRCm39) missense probably benign 0.03
R1109:Lpin3 UTSW 2 160,740,941 (GRCm39) missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160,735,999 (GRCm39) missense probably benign 0.03
R1404:Lpin3 UTSW 2 160,734,310 (GRCm39) critical splice donor site probably null
R1404:Lpin3 UTSW 2 160,734,310 (GRCm39) critical splice donor site probably null
R1513:Lpin3 UTSW 2 160,746,468 (GRCm39) missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160,737,310 (GRCm39) missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160,738,729 (GRCm39) nonsense probably null
R1786:Lpin3 UTSW 2 160,738,729 (GRCm39) nonsense probably null
R1896:Lpin3 UTSW 2 160,747,218 (GRCm39) missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160,740,565 (GRCm39) missense probably benign
R4470:Lpin3 UTSW 2 160,737,354 (GRCm39) missense probably benign 0.00
R4996:Lpin3 UTSW 2 160,747,207 (GRCm39) missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160,746,748 (GRCm39) missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160,738,981 (GRCm39) missense probably benign
R5184:Lpin3 UTSW 2 160,739,058 (GRCm39) missense probably benign
R5405:Lpin3 UTSW 2 160,745,849 (GRCm39) missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160,746,936 (GRCm39) missense probably damaging 1.00
R5670:Lpin3 UTSW 2 160,739,250 (GRCm39) missense probably benign
R5693:Lpin3 UTSW 2 160,737,320 (GRCm39) missense probably benign 0.00
R6084:Lpin3 UTSW 2 160,737,721 (GRCm39) missense probably benign 0.38
R6994:Lpin3 UTSW 2 160,746,803 (GRCm39) missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160,738,672 (GRCm39) missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160,740,627 (GRCm39) missense probably benign 0.02
R7207:Lpin3 UTSW 2 160,735,923 (GRCm39) nonsense probably null
R7430:Lpin3 UTSW 2 160,740,586 (GRCm39) missense probably benign 0.06
R7459:Lpin3 UTSW 2 160,739,220 (GRCm39) missense probably benign 0.06
R7603:Lpin3 UTSW 2 160,745,674 (GRCm39) splice site probably null
R7644:Lpin3 UTSW 2 160,738,690 (GRCm39) missense probably benign 0.02
R7706:Lpin3 UTSW 2 160,747,210 (GRCm39) missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160,737,310 (GRCm39) missense possibly damaging 0.69
R8443:Lpin3 UTSW 2 160,737,273 (GRCm39) missense probably damaging 1.00
R8985:Lpin3 UTSW 2 160,738,674 (GRCm39) missense probably benign 0.00
R9288:Lpin3 UTSW 2 160,745,552 (GRCm39) missense probably damaging 1.00
R9385:Lpin3 UTSW 2 160,738,993 (GRCm39) missense probably benign
R9455:Lpin3 UTSW 2 160,737,259 (GRCm39) missense probably benign 0.02
R9482:Lpin3 UTSW 2 160,746,416 (GRCm39) missense probably damaging 1.00
R9700:Lpin3 UTSW 2 160,740,565 (GRCm39) missense probably benign 0.11
R9732:Lpin3 UTSW 2 160,734,196 (GRCm39) missense probably damaging 1.00
X0002:Lpin3 UTSW 2 160,745,637 (GRCm39) missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160,734,151 (GRCm39) missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160,741,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCAGGGCTGATACATTC -3'
(R):5'- ATCTGGTCTATGCTAGGCTCTC -3'

Sequencing Primer
(F):5'- GAGTCAGGGCTGATACATTCCATCC -3'
(R):5'- ATTTGGCTCCTCCATGGGACTG -3'
Posted On 2016-11-09