Incidental Mutation 'H8786:Sez6l2'
ID44441
Institutional Source Beutler Lab
Gene Symbol Sez6l2
Ensembl Gene ENSMUSG00000030683
Gene Nameseizure related 6 homolog like 2
SynonymsPsk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126950563-126970606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126961783 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 413 (N413K)
Ref Sequence ENSEMBL: ENSMUSP00000101939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106332] [ENSMUST00000106333] [ENSMUST00000106335] [ENSMUST00000146017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106332
AA Change: N413K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101939
Gene: ENSMUSG00000030683
AA Change: N413K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
CUB 113 226 8.25e-4 SMART
CCP 230 285 3.75e-15 SMART
CUB 289 399 1.3e-3 SMART
CCP 404 463 8.9e-8 SMART
CUB 467 578 3.45e-14 SMART
CCP 584 639 1.18e-12 SMART
CCP 645 704 1.31e-14 SMART
CCP 711 768 2.76e-13 SMART
transmembrane domain 798 820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106333
AA Change: N473K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101940
Gene: ENSMUSG00000030683
AA Change: N473K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 858 880 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106335
AA Change: N473K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101942
Gene: ENSMUSG00000030683
AA Change: N473K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 115 146 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
CUB 173 286 8.25e-4 SMART
CCP 290 345 3.75e-15 SMART
CUB 349 459 1.3e-3 SMART
CCP 464 523 8.9e-8 SMART
CUB 527 638 3.45e-14 SMART
CCP 644 699 1.18e-12 SMART
CCP 705 764 1.31e-14 SMART
CCP 771 828 2.76e-13 SMART
transmembrane domain 845 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125669
Predicted Effect probably benign
Transcript: ENSMUST00000146017
SMART Domains Protein: ENSMUSP00000115905
Gene: ENSMUSG00000030683

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 72 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no apparent defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Sez6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Sez6l2 APN 7 126961883 missense possibly damaging 0.91
IGL01710:Sez6l2 APN 7 126968216 missense probably damaging 1.00
IGL02439:Sez6l2 APN 7 126968189 missense probably damaging 0.99
IGL02752:Sez6l2 APN 7 126953733 missense probably damaging 1.00
R0783:Sez6l2 UTSW 7 126967145 missense possibly damaging 0.65
R0989:Sez6l2 UTSW 7 126959844 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1148:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1493:Sez6l2 UTSW 7 126961812 missense probably damaging 1.00
R1509:Sez6l2 UTSW 7 126963363 missense probably damaging 1.00
R1704:Sez6l2 UTSW 7 126958341 missense probably damaging 1.00
R1817:Sez6l2 UTSW 7 126967119 missense probably damaging 1.00
R1889:Sez6l2 UTSW 7 126953496 missense probably damaging 1.00
R2509:Sez6l2 UTSW 7 126953772 missense probably benign 0.31
R3772:Sez6l2 UTSW 7 126959203 missense probably damaging 0.99
R4466:Sez6l2 UTSW 7 126959851 missense probably damaging 0.97
R4869:Sez6l2 UTSW 7 126961842 missense probably benign 0.02
R5155:Sez6l2 UTSW 7 126962373 missense probably damaging 0.99
R5416:Sez6l2 UTSW 7 126961886 missense probably damaging 1.00
R5551:Sez6l2 UTSW 7 126966830 missense probably damaging 1.00
R5884:Sez6l2 UTSW 7 126970156 unclassified probably benign
R5903:Sez6l2 UTSW 7 126970133 unclassified probably benign
R6015:Sez6l2 UTSW 7 126953453 missense probably damaging 0.97
R6726:Sez6l2 UTSW 7 126968005 missense probably damaging 0.96
R7094:Sez6l2 UTSW 7 126952924 missense probably damaging 0.99
R7117:Sez6l2 UTSW 7 126953743 missense possibly damaging 0.94
R7228:Sez6l2 UTSW 7 126953725 missense probably damaging 1.00
R7479:Sez6l2 UTSW 7 126963659 missense probably damaging 1.00
R7502:Sez6l2 UTSW 7 126961743 missense probably benign 0.26
Z1176:Sez6l2 UTSW 7 126958331 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGCTCCCAAAGCCAAATGTCTG -3'
(R):5'- TGGAACATGAGGGCTTACCCTTGC -3'

Sequencing Primer
(F):5'- tggaaggctgaggaaagaag -3'
(R):5'- GTGGGATCCACACATTCGATAG -3'
Posted On2013-06-11