Incidental Mutation 'R5666:Tex52'
ID444425
Institutional Source Beutler Lab
Gene Symbol Tex52
Ensembl Gene ENSMUSG00000079304
Gene Nametestis expressed 52
Synonyms4933413G19Rik
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128375456-128385144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128375555 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000145112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000112148] [ENSMUST00000130785] [ENSMUST00000203040] [ENSMUST00000204223]
Predicted Effect probably benign
Transcript: ENSMUST00000073316
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100926
AA Change: S13P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112148
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect probably benign
Transcript: ENSMUST00000130785
AA Change: S13P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect probably benign
Transcript: ENSMUST00000203040
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203779
Predicted Effect unknown
Transcript: ENSMUST00000204223
AA Change: S13P
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Tex52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02528:Tex52 APN 6 128379497 missense possibly damaging 0.60
IGL03304:Tex52 APN 6 128379532 missense possibly damaging 0.55
R0384:Tex52 UTSW 6 128379533 missense probably damaging 1.00
R0462:Tex52 UTSW 6 128384954 missense probably benign
R2398:Tex52 UTSW 6 128379577 missense probably damaging 1.00
R2413:Tex52 UTSW 6 128379908 missense probably damaging 1.00
R4856:Tex52 UTSW 6 128384988 unclassified probably null
R5230:Tex52 UTSW 6 128384816 missense probably damaging 1.00
R5864:Tex52 UTSW 6 128379682 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTAACCAGAACTGACAGCG -3'
(R):5'- AAGGCCTCTTCAACCTGTTG -3'

Sequencing Primer
(F):5'- ACTGAGGAGCCTCCCAG -3'
(R):5'- TCTTCAACCTGTTGCCCAG -3'
Posted On2016-11-09