Incidental Mutation 'H8786:4933402N03Rik'
Institutional Source Beutler Lab
Gene Symbol 4933402N03Rik
Ensembl Gene ENSMUSG00000013668
Gene NameRIKEN cDNA 4933402N03 gene
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosomal Location131137713-131146314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131139177 bp
Amino Acid Change Arginine to Serine at position 103 (R103S)
Ref Sequence ENSEMBL: ENSMUSP00000070291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070980] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000070980
AA Change: R103S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in 4933402N03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:4933402N03Rik APN 7 131138621 missense probably benign 0.14
IGL01374:4933402N03Rik APN 7 131146101 missense probably benign 0.34
IGL01394:4933402N03Rik APN 7 131146231 nonsense probably null
IGL01640:4933402N03Rik APN 7 131139119 missense possibly damaging 0.90
IGL01713:4933402N03Rik APN 7 131139043 missense possibly damaging 0.92
R0321:4933402N03Rik UTSW 7 131146227 missense probably benign 0.00
R0496:4933402N03Rik UTSW 7 131146131 missense probably benign
R0541:4933402N03Rik UTSW 7 131139143 missense probably benign 0.01
R1527:4933402N03Rik UTSW 7 131138860 missense probably benign 0.10
R1750:4933402N03Rik UTSW 7 131146130 missense probably benign 0.09
R2047:4933402N03Rik UTSW 7 131146107 missense probably damaging 0.96
R2404:4933402N03Rik UTSW 7 131139194 missense possibly damaging 0.94
R3881:4933402N03Rik UTSW 7 131139094 missense probably benign 0.19
R4507:4933402N03Rik UTSW 7 131145872 missense probably damaging 1.00
R4684:4933402N03Rik UTSW 7 131138684 missense probably damaging 0.96
R5368:4933402N03Rik UTSW 7 131139196 missense possibly damaging 0.92
R5814:4933402N03Rik UTSW 7 131139082 missense probably benign 0.09
R6238:4933402N03Rik UTSW 7 131146134 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaagctcttgagttttagctacc -3'
Posted On2013-06-11