Incidental Mutation 'R5666:Tmprss13'
ID 444434
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Name transmembrane protease, serine 13
Synonyms
MMRRC Submission 043309-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5666 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 45230398-45258879 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45256253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 456 (I456V)
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034597
AA Change: I456V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129
AA Change: I456V

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Abce1 C A 8: 80,416,906 (GRCm39) E368D probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Bop1 T C 15: 76,338,433 (GRCm39) E503G probably benign Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Chd3 T C 11: 69,244,177 (GRCm39) E1202G possibly damaging Het
Cmya5 T C 13: 93,182,457 (GRCm39) I3568V possibly damaging Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Cpxm2 C T 7: 131,656,625 (GRCm39) E546K probably benign Het
Cyp2j5 C T 4: 96,546,930 (GRCm39) V195I probably benign Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
E2f1 T A 2: 154,411,101 (GRCm39) probably benign Het
Ephb3 A G 16: 21,041,241 (GRCm39) N732S probably benign Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Foxm1 C T 6: 128,350,130 (GRCm39) S339L possibly damaging Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Gfpt1 A T 6: 87,030,795 (GRCm39) I60F possibly damaging Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Hs2st1 A T 3: 144,275,554 (GRCm39) V22E probably damaging Het
Hspa9 T C 18: 35,087,300 (GRCm39) I2V probably null Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Myh1 T A 11: 67,112,178 (GRCm39) I1744N probably benign Het
Nadsyn1 C T 7: 143,361,168 (GRCm39) G335S probably damaging Het
Ndc1 T C 4: 107,246,723 (GRCm39) V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nmt1 C T 11: 102,949,041 (GRCm39) R299* probably null Het
Or1j20 T A 2: 36,760,401 (GRCm39) D274E probably benign Het
Or2y8 A C 11: 52,035,525 (GRCm39) Y277* probably null Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Padi2 G T 4: 140,676,542 (GRCm39) R560L possibly damaging Het
Palmd T C 3: 116,717,750 (GRCm39) N249S possibly damaging Het
Pde1c A C 6: 56,103,842 (GRCm39) probably null Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pla2g2d T A 4: 138,507,591 (GRCm39) C82S probably damaging Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Slc7a4 A G 16: 17,393,815 (GRCm39) probably benign Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Sstr2 T A 11: 113,515,539 (GRCm39) W153R probably damaging Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tas2r130 T C 6: 131,607,342 (GRCm39) N151S possibly damaging Het
Tex52 T C 6: 128,352,518 (GRCm39) S13P probably benign Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45,247,403 (GRCm39) missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45,250,702 (GRCm39) missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45,244,972 (GRCm39) missense probably benign
IGL02669:Tmprss13 APN 9 45,243,824 (GRCm39) missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45,256,301 (GRCm39) missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45,239,856 (GRCm39) missense unknown
R0233:Tmprss13 UTSW 9 45,248,398 (GRCm39) splice site probably benign
R0271:Tmprss13 UTSW 9 45,244,986 (GRCm39) splice site probably benign
R0415:Tmprss13 UTSW 9 45,248,430 (GRCm39) splice site probably null
R0742:Tmprss13 UTSW 9 45,243,765 (GRCm39) missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45,239,945 (GRCm39) missense unknown
R1447:Tmprss13 UTSW 9 45,239,878 (GRCm39) missense unknown
R1493:Tmprss13 UTSW 9 45,247,405 (GRCm39) missense probably benign 0.00
R1574:Tmprss13 UTSW 9 45,254,529 (GRCm39) missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45,254,529 (GRCm39) missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45,249,616 (GRCm39) missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45,243,843 (GRCm39) missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45,256,340 (GRCm39) missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45,256,253 (GRCm39) missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45,256,630 (GRCm39) missense probably damaging 1.00
R6343:Tmprss13 UTSW 9 45,254,498 (GRCm39) missense possibly damaging 0.66
R6583:Tmprss13 UTSW 9 45,256,603 (GRCm39) missense probably damaging 1.00
R6671:Tmprss13 UTSW 9 45,254,529 (GRCm39) missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45,247,399 (GRCm39) nonsense probably null
R7135:Tmprss13 UTSW 9 45,249,643 (GRCm39) missense probably damaging 1.00
R7468:Tmprss13 UTSW 9 45,239,721 (GRCm39) missense unknown
R7617:Tmprss13 UTSW 9 45,244,858 (GRCm39) nonsense probably null
R8062:Tmprss13 UTSW 9 45,239,986 (GRCm39) missense unknown
R8871:Tmprss13 UTSW 9 45,249,704 (GRCm39) missense probably damaging 0.97
RF009:Tmprss13 UTSW 9 45,239,762 (GRCm39) small insertion probably benign
RF039:Tmprss13 UTSW 9 45,239,762 (GRCm39) small insertion probably benign
S24628:Tmprss13 UTSW 9 45,248,430 (GRCm39) splice site probably null
Z1177:Tmprss13 UTSW 9 45,254,490 (GRCm39) missense probably benign 0.04
Z1177:Tmprss13 UTSW 9 45,248,388 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATGCGGTGCCCTCTACTC -3'
(R):5'- GTGAGTCGGTCTGGTGCAAAAG -3'

Sequencing Primer
(F):5'- TCTACTCCCAGGAGGCTAGG -3'
(R):5'- TCAGGAAAGAGCGGCTCTC -3'
Posted On 2016-11-09