Mutagenetix > Incidental Mutation

Incidental Mutation 'R5666:Gm4787'

444445

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

MMRRC Submission

043309-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R5666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 81378031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 451 (T451I)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

AlphaFold

B2RUD9

Predicted Effect

probably benign
Transcript: ENSMUST00000062182
AA Change: T451I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T451I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000087222

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930524J08Rik	T	C	5: 99,979,209		probably benign	Het
Abce1	C	A	8: 79,690,277	E368D	probably benign	Het
Bmper	T	A	9: 23,473,463	M588K	probably damaging	Het
Bop1	T	C	15: 76,454,233	E503G	probably benign	Het
Btla	A	T	16: 45,250,419	D247V	probably damaging	Het
Cap2	T	A	13: 46,531,083		probably null	Het
Chd2	A	T	7: 73,441,717	I1592K	probably benign	Het
Chd3	T	C	11: 69,353,351	E1202G	possibly damaging	Het
Cmya5	T	C	13: 93,045,949	I3568V	possibly damaging	Het
Col4a4	A	G	1: 82,485,579		probably null	Het
Cpxm2	C	T	7: 132,054,896	E546K	probably benign	Het
Cyp2j5	C	T	4: 96,658,693	V195I	probably benign	Het
Ddb2	C	T	2: 91,212,581	V353M	probably damaging	Het
Dscam	G	A	16: 96,718,164	T791I	probably benign	Het
Dtd2	T	A	12: 51,999,860	L65F	probably damaging	Het
E2f1	T	A	2: 154,569,181		probably benign	Het
Ephb3	A	G	16: 21,222,491	N732S	probably benign	Het
Fkbp10	G	T	11: 100,423,526	W384L	probably damaging	Het
Foxm1	C	T	6: 128,373,167	S339L	possibly damaging	Het
Fzd6	A	T	15: 39,031,115	R225S	probably benign	Het
Gfpt1	A	T	6: 87,053,813	I60F	possibly damaging	Het
Glce	A	G	9: 62,060,511	S453P	probably damaging	Het
Gm38100	C	T	1: 175,921,613	T415M	probably damaging	Het
Hs2st1	A	T	3: 144,569,793	V22E	probably damaging	Het
Hspa9	T	C	18: 34,954,247	I2V	probably null	Het
Ikzf2	A	G	1: 69,577,900	V96A	probably benign	Het
Ilkap	T	C	1: 91,391,141	T38A	probably benign	Het
Lpin3	A	G	2: 160,897,330	T353A	probably benign	Het
Myh1	T	A	11: 67,221,352	I1744N	probably benign	Het
Nadsyn1	C	T	7: 143,807,431	G335S	probably damaging	Het
Ndc1	T	C	4: 107,389,526	V382A	possibly damaging	Het
Ndufaf4	A	T	4: 24,898,636	D64V	probably damaging	Het
Nfe2l2	T	C	2: 75,677,118	T213A	probably benign	Het
Nkain4	A	G	2: 180,943,202	L73P	probably damaging	Het
Nmt1	C	T	11: 103,058,215	R299*	probably null	Het
Olfr1271	T	C	2: 90,265,964	I155M	probably benign	Het
Olfr1373	A	C	11: 52,144,698	Y277*	probably null	Het
Olfr173	G	A	16: 58,797,061	P262S	possibly damaging	Het
Olfr352	T	A	2: 36,870,389	D274E	probably benign	Het
Padi2	G	T	4: 140,949,231	R560L	possibly damaging	Het
Palmd	T	C	3: 116,924,101	N249S	possibly damaging	Het
Pde1c	A	C	6: 56,126,857		probably null	Het
Pdgfra	T	C	5: 75,173,495	S410P	probably benign	Het
Phldb1	T	C	9: 44,715,781	M456V	probably damaging	Het
Pla2g2d	T	A	4: 138,780,280	C82S	probably damaging	Het
Rgs21	A	G	1: 144,536,942	V48A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Slc4a2	G	T	5: 24,434,838	V506L	probably damaging	Het
Slc7a4	A	G	16: 17,575,951		probably benign	Het
Sptbn5	C	G	2: 120,085,567		probably benign	Het
Sstr2	T	A	11: 113,624,713	W153R	probably damaging	Het
Steap2	C	T	5: 5,673,681	V400I	probably benign	Het
Syne2	G	A	12: 75,950,959	G2236D	probably benign	Het
Tas2r130	T	C	6: 131,630,379	N151S	possibly damaging	Het
Tex52	T	C	6: 128,375,555	S13P	probably benign	Het
Tmprss13	A	G	9: 45,344,955	I456V	probably damaging	Het
Trim24	T	C	6: 37,965,601	F946S	probably benign	Het
Vmn2r10	A	T	5: 108,999,044	Y459*	probably null	Het
Vwa1	A	G	4: 155,774,465	L13P	probably damaging	Het
Zfp648	C	A	1: 154,204,217	Q41K	probably benign	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2030:Gm4787	UTSW	12	81378770	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4038:Gm4787	UTSW	12	81378358	missense	probably damaging	1.00
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5031:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R8515:Gm4787	UTSW	12	81377269	missense	probably benign	0.00
R9103:Gm4787	UTSW	12	81378715	missense	probably benign	0.06
R9457:Gm4787	UTSW	12	81379246	missense	probably damaging	1.00
R9557:Gm4787	UTSW	12	81379300	nonsense	probably null
R9608:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
V7580:Gm4787	UTSW	12	81377567	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTGCAAATGACGGTCAG -3'
(R):5'- TGTGCTACATATGAGGATCCATG -3'

Sequencing Primer
(F):5'- GCAAATGACGGTCAGTACAGTTTCC -3'
(R):5'- ACATATGAGGATCCATGGTTGGGATC -3'

Posted On

2016-11-09