Incidental Mutation 'R5666:Gm4787'
ID444445
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 043309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81378031 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 451 (T451I)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: T451I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T451I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACTGCAAATGACGGTCAG -3'
(R):5'- TGTGCTACATATGAGGATCCATG -3'

Sequencing Primer
(F):5'- GCAAATGACGGTCAGTACAGTTTCC -3'
(R):5'- ACATATGAGGATCCATGGTTGGGATC -3'
Posted On2016-11-09