Incidental Mutation 'R5666:Ephb3'
ID 444451
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene Name Eph receptor B3
Synonyms Cek10, Tyro6, Etk2, Sek4, MDK5, HEK2
MMRRC Submission 043309-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.927) question?
Stock # R5666 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 21023530-21042054 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21041241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 732 (N732S)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
AlphaFold P54754
Predicted Effect probably benign
Transcript: ENSMUST00000006112
AA Change: N986S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: N986S

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect probably benign
Transcript: ENSMUST00000161063
AA Change: N732S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 100,127,068 (GRCm39) probably benign Het
Abce1 C A 8: 80,416,906 (GRCm39) E368D probably benign Het
Becn2 C T 1: 175,749,179 (GRCm39) T415M probably damaging Het
Bmper T A 9: 23,384,759 (GRCm39) M588K probably damaging Het
Bop1 T C 15: 76,338,433 (GRCm39) E503G probably benign Het
Btla A T 16: 45,070,782 (GRCm39) D247V probably damaging Het
Cap2 T A 13: 46,684,559 (GRCm39) probably null Het
Chd2 A T 7: 73,091,465 (GRCm39) I1592K probably benign Het
Chd3 T C 11: 69,244,177 (GRCm39) E1202G possibly damaging Het
Cmya5 T C 13: 93,182,457 (GRCm39) I3568V possibly damaging Het
Col4a4 A G 1: 82,463,300 (GRCm39) probably null Het
Cpxm2 C T 7: 131,656,625 (GRCm39) E546K probably benign Het
Cyp2j5 C T 4: 96,546,930 (GRCm39) V195I probably benign Het
Ddb2 C T 2: 91,042,926 (GRCm39) V353M probably damaging Het
Dscam G A 16: 96,519,364 (GRCm39) T791I probably benign Het
Dtd2 T A 12: 52,046,643 (GRCm39) L65F probably damaging Het
E2f1 T A 2: 154,411,101 (GRCm39) probably benign Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Foxm1 C T 6: 128,350,130 (GRCm39) S339L possibly damaging Het
Fzd6 A T 15: 38,894,510 (GRCm39) R225S probably benign Het
Gfpt1 A T 6: 87,030,795 (GRCm39) I60F possibly damaging Het
Glce A G 9: 61,967,793 (GRCm39) S453P probably damaging Het
Gm4787 G A 12: 81,424,805 (GRCm39) T451I probably benign Het
Hs2st1 A T 3: 144,275,554 (GRCm39) V22E probably damaging Het
Hspa9 T C 18: 35,087,300 (GRCm39) I2V probably null Het
Ikzf2 A G 1: 69,617,059 (GRCm39) V96A probably benign Het
Ilkap T C 1: 91,318,863 (GRCm39) T38A probably benign Het
Lpin3 A G 2: 160,739,250 (GRCm39) T353A probably benign Het
Myh1 T A 11: 67,112,178 (GRCm39) I1744N probably benign Het
Nadsyn1 C T 7: 143,361,168 (GRCm39) G335S probably damaging Het
Ndc1 T C 4: 107,246,723 (GRCm39) V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 (GRCm39) D64V probably damaging Het
Nfe2l2 T C 2: 75,507,462 (GRCm39) T213A probably benign Het
Nkain4 A G 2: 180,584,995 (GRCm39) L73P probably damaging Het
Nmt1 C T 11: 102,949,041 (GRCm39) R299* probably null Het
Or1j20 T A 2: 36,760,401 (GRCm39) D274E probably benign Het
Or2y8 A C 11: 52,035,525 (GRCm39) Y277* probably null Het
Or4b12 T C 2: 90,096,308 (GRCm39) I155M probably benign Het
Or5k1 G A 16: 58,617,424 (GRCm39) P262S possibly damaging Het
Padi2 G T 4: 140,676,542 (GRCm39) R560L possibly damaging Het
Palmd T C 3: 116,717,750 (GRCm39) N249S possibly damaging Het
Pde1c A C 6: 56,103,842 (GRCm39) probably null Het
Pdgfra T C 5: 75,334,156 (GRCm39) S410P probably benign Het
Phldb1 T C 9: 44,627,078 (GRCm39) M456V probably damaging Het
Pla2g2d T A 4: 138,507,591 (GRCm39) C82S probably damaging Het
Rgs21 A G 1: 144,412,680 (GRCm39) V48A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Slc4a2 G T 5: 24,639,836 (GRCm39) V506L probably damaging Het
Slc7a4 A G 16: 17,393,815 (GRCm39) probably benign Het
Sptbn5 C G 2: 119,916,048 (GRCm39) probably benign Het
Sstr2 T A 11: 113,515,539 (GRCm39) W153R probably damaging Het
Steap2 C T 5: 5,723,681 (GRCm39) V400I probably benign Het
Syne2 G A 12: 75,997,733 (GRCm39) G2236D probably benign Het
Tas2r130 T C 6: 131,607,342 (GRCm39) N151S possibly damaging Het
Tex52 T C 6: 128,352,518 (GRCm39) S13P probably benign Het
Tmprss13 A G 9: 45,256,253 (GRCm39) I456V probably damaging Het
Trim24 T C 6: 37,942,536 (GRCm39) F946S probably benign Het
Vmn2r10 A T 5: 109,146,910 (GRCm39) Y459* probably null Het
Vwa1 A G 4: 155,858,922 (GRCm39) L13P probably damaging Het
Zfp648 C A 1: 154,079,963 (GRCm39) Q41K probably benign Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21,039,165 (GRCm39) splice site probably null
IGL00966:Ephb3 APN 16 21,036,044 (GRCm39) missense probably benign 0.00
IGL02166:Ephb3 APN 16 21,039,499 (GRCm39) missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21,040,174 (GRCm39) missense probably benign 0.04
IGL02321:Ephb3 APN 16 21,033,139 (GRCm39) missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21,040,253 (GRCm39) splice site probably null
IGL02507:Ephb3 APN 16 21,039,389 (GRCm39) splice site probably benign
IGL02755:Ephb3 APN 16 21,040,448 (GRCm39) missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21,041,031 (GRCm39) missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21,039,607 (GRCm39) missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21,033,667 (GRCm39) missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21,036,859 (GRCm39) missense probably benign 0.01
R0196:Ephb3 UTSW 16 21,036,804 (GRCm39) missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21,039,525 (GRCm39) missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21,037,784 (GRCm39) unclassified probably benign
R1126:Ephb3 UTSW 16 21,041,226 (GRCm39) missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21,037,672 (GRCm39) missense probably benign
R1592:Ephb3 UTSW 16 21,040,450 (GRCm39) missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21,031,687 (GRCm39) missense probably benign 0.00
R1694:Ephb3 UTSW 16 21,040,495 (GRCm39) missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21,039,400 (GRCm39) missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21,035,985 (GRCm39) missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21,041,045 (GRCm39) missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21,040,132 (GRCm39) missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21,036,993 (GRCm39) missense probably benign
R3408:Ephb3 UTSW 16 21,038,254 (GRCm39) missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21,040,447 (GRCm39) missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21,033,213 (GRCm39) missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21,040,958 (GRCm39) missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21,033,745 (GRCm39) missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21,033,745 (GRCm39) missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21,039,245 (GRCm39) missense probably benign 0.09
R5057:Ephb3 UTSW 16 21,039,197 (GRCm39) missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21,033,237 (GRCm39) missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21,037,855 (GRCm39) missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21,039,610 (GRCm39) missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21,036,869 (GRCm39) missense probably damaging 1.00
R5838:Ephb3 UTSW 16 21,040,437 (GRCm39) missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21,030,129 (GRCm39) intron probably benign
R6017:Ephb3 UTSW 16 21,040,781 (GRCm39) missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21,040,763 (GRCm39) missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21,036,861 (GRCm39) missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21,040,218 (GRCm39) missense probably benign
R6591:Ephb3 UTSW 16 21,033,223 (GRCm39) missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21,033,223 (GRCm39) missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21,037,268 (GRCm39) missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21,037,577 (GRCm39) nonsense probably null
R7236:Ephb3 UTSW 16 21,033,231 (GRCm39) missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21,040,976 (GRCm39) missense probably benign 0.04
R7410:Ephb3 UTSW 16 21,040,158 (GRCm39) missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21,033,457 (GRCm39) missense probably damaging 1.00
R7452:Ephb3 UTSW 16 21,036,107 (GRCm39) splice site probably null
R7944:Ephb3 UTSW 16 21,040,434 (GRCm39) missense probably damaging 1.00
R7945:Ephb3 UTSW 16 21,040,434 (GRCm39) missense probably damaging 1.00
R9092:Ephb3 UTSW 16 21,041,214 (GRCm39) missense probably benign 0.01
R9504:Ephb3 UTSW 16 21,036,830 (GRCm39) missense possibly damaging 0.48
R9706:Ephb3 UTSW 16 21,039,193 (GRCm39) missense probably damaging 1.00
Z1176:Ephb3 UTSW 16 21,036,786 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGCAGAGTAAGTGTACCGCTC -3'
(R):5'- AAGAGGTTTGGGGCACACTTC -3'

Sequencing Primer
(F):5'- TAAGTGTACCGCTCAAGGTGC -3'
(R):5'- TTCCTGGGAGGGAGCACAG -3'
Posted On 2016-11-09