Incidental Mutation 'R5666:Dscam'
ID444454
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 043309-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5666 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96718164 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 791 (T791I)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: T791I

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: T791I

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Abce1 C A 8: 79,690,277 E368D probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Bop1 T C 15: 76,454,233 E503G probably benign Het
Btla A T 16: 45,250,419 D247V probably damaging Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Chd3 T C 11: 69,353,351 E1202G possibly damaging Het
Cmya5 T C 13: 93,045,949 I3568V possibly damaging Het
Col4a4 A G 1: 82,485,579 probably null Het
Cpxm2 C T 7: 132,054,896 E546K probably benign Het
Cyp2j5 C T 4: 96,658,693 V195I probably benign Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
E2f1 T A 2: 154,569,181 probably benign Het
Ephb3 A G 16: 21,222,491 N732S probably benign Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Foxm1 C T 6: 128,373,167 S339L possibly damaging Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Gfpt1 A T 6: 87,053,813 I60F possibly damaging Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Hs2st1 A T 3: 144,569,793 V22E probably damaging Het
Hspa9 T C 18: 34,954,247 I2V probably null Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Myh1 T A 11: 67,221,352 I1744N probably benign Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Ndc1 T C 4: 107,389,526 V382A possibly damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nmt1 C T 11: 103,058,215 R299* probably null Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1373 A C 11: 52,144,698 Y277* probably null Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr352 T A 2: 36,870,389 D274E probably benign Het
Padi2 G T 4: 140,949,231 R560L possibly damaging Het
Palmd T C 3: 116,924,101 N249S possibly damaging Het
Pde1c A C 6: 56,126,857 probably null Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pla2g2d T A 4: 138,780,280 C82S probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Slc7a4 A G 16: 17,575,951 probably benign Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Sstr2 T A 11: 113,624,713 W153R probably damaging Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tas2r130 T C 6: 131,630,379 N151S possibly damaging Het
Tex52 T C 6: 128,375,555 S13P probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R7926:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7961:Dscam UTSW 16 96709421 intron probably null
R7992:Dscam UTSW 16 96643922 missense probably benign 0.01
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGCGTAGATATCACTTCCTC -3'
(R):5'- TGAACCTGCAAGGCATTTTCTG -3'

Sequencing Primer
(F):5'- GCGTAGATATCACTTCCTCTCCCAC -3'
(R):5'- GGTAGGCCAGCTTTGTTTCTCC -3'
Posted On2016-11-09