Incidental Mutation 'R5667:Kank4'
List |< first << previous [record 33 of 54] next >> last >|
ID444465
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98765461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790] [ENSMUST00000102790]
Predicted Effect probably null
Transcript: ENSMUST00000102790
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102790
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137270
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5550:Kank4 UTSW 4 98771441 missense probably benign 0.27
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGCTCAGTGACCCTTATG -3'
(R):5'- CAACTTGACTGTTCCAGCACC -3'

Sequencing Primer
(F):5'- TATGCCAGCCTGTCAAAGTC -3'
(R):5'- GACTGTTCCAGCACCCATTC -3'
Posted On2016-11-09