Incidental Mutation 'R5667:Trpv4'
ID444469
Institutional Source Beutler Lab
Gene Symbol Trpv4
Ensembl Gene ENSMUSG00000014158
Gene Nametransient receptor potential cation channel, subfamily V, member 4
SynonymsVROAC, 0610033B08Rik, Trp12, VR-OAC, VRL-2, OTRPC4
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114622152-114658421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114634556 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 371 (L371P)
Ref Sequence ENSEMBL: ENSMUSP00000107836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071968] [ENSMUST00000112217] [ENSMUST00000112219] [ENSMUST00000112222] [ENSMUST00000112225]
Predicted Effect probably damaging
Transcript: ENSMUST00000071968
AA Change: L371P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071859
Gene: ENSMUSG00000014158
AA Change: L371P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 468 730 9.9e-13 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112217
AA Change: L371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107836
Gene: ENSMUSG00000014158
AA Change: L371P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 1e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 2e-12 BLAST
ANK 369 397 1.02e3 SMART
transmembrane domain 409 431 N/A INTRINSIC
Pfam:Ion_trans 455 658 3.3e-8 PFAM
Blast:PHB 693 744 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112219
AA Change: L324P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107838
Gene: ENSMUSG00000014158
AA Change: L324P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 350 1.02e3 SMART
transmembrane domain 362 384 N/A INTRINSIC
Pfam:Ion_trans 408 611 3e-8 PFAM
Blast:PHB 646 697 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112222
AA Change: L324P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107840
Gene: ENSMUSG00000014158
AA Change: L324P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 351 3.49e0 SMART
low complexity region 368 378 N/A INTRINSIC
Blast:ANK 395 420 1e-6 BLAST
Pfam:Ion_trans 468 671 3.4e-8 PFAM
Blast:PHB 706 757 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112225
AA Change: L371P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107844
Gene: ENSMUSG00000014158
AA Change: L371P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 515 718 3.4e-8 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212469
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a null allele show abnormal touch/ nociception and late-onset hearing loss. Homozygotes for a different null allele show impaired bladder voiding, abnormalities in touch/ nociception, osmotic regulation and vasodilation, ocular hypertension but no hearing or vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Trpv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trpv4 APN 5 114628625 missense probably damaging 1.00
IGL01804:Trpv4 APN 5 114644786 missense possibly damaging 0.77
IGL01955:Trpv4 APN 5 114622682 nonsense probably null
IGL02115:Trpv4 APN 5 114625029 missense probably damaging 1.00
IGL02375:Trpv4 APN 5 114636357 missense probably benign 0.10
IGL02870:Trpv4 APN 5 114625056 missense probably damaging 1.00
PIT4472001:Trpv4 UTSW 5 114626923 missense probably damaging 0.99
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0217:Trpv4 UTSW 5 114634661 missense possibly damaging 0.68
R0346:Trpv4 UTSW 5 114630529 splice site probably benign
R0358:Trpv4 UTSW 5 114630432 missense probably damaging 1.00
R1745:Trpv4 UTSW 5 114633154 missense probably damaging 1.00
R1880:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R1881:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R2018:Trpv4 UTSW 5 114634605 missense probably damaging 1.00
R2093:Trpv4 UTSW 5 114635504 missense probably damaging 1.00
R2172:Trpv4 UTSW 5 114644710 missense probably damaging 1.00
R2679:Trpv4 UTSW 5 114635552 missense probably damaging 1.00
R3699:Trpv4 UTSW 5 114634800 missense probably damaging 1.00
R4731:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4732:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4733:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4822:Trpv4 UTSW 5 114630022 missense possibly damaging 0.66
R4985:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R4987:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R5026:Trpv4 UTSW 5 114622654 makesense probably null
R5105:Trpv4 UTSW 5 114626920 missense probably damaging 1.00
R5236:Trpv4 UTSW 5 114622795 missense possibly damaging 0.81
R5330:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5331:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5396:Trpv4 UTSW 5 114623614 missense possibly damaging 0.77
R5423:Trpv4 UTSW 5 114636445 missense probably benign 0.25
R5896:Trpv4 UTSW 5 114622647 utr 3 prime probably benign
R6239:Trpv4 UTSW 5 114644826 missense probably benign
R6762:Trpv4 UTSW 5 114625110 missense probably benign 0.07
R6952:Trpv4 UTSW 5 114633202 missense probably damaging 1.00
R7191:Trpv4 UTSW 5 114633140 missense probably benign
R7343:Trpv4 UTSW 5 114636459 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CCCGGGAGAATGACATTATGTGG -3'
(R):5'- CGCACATCGTCAACTACCTG -3'

Sequencing Primer
(F):5'- GGTTTTAGATAAAGCAGAGCTATAGC -3'
(R):5'- CCTCACAAGAAAGCTGACATGAGG -3'
Posted On2016-11-09