Mutagenetix > Incidental Mutation

Incidental Mutation 'R5667:Flnb'

444497

Institutional Source

Beutler Lab

Gene Symbol

Flnb

Ensembl Gene

ENSMUSG00000025278

Gene Name

filamin, beta

Synonyms

MMRRC Submission

043310-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5667 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7817957-7951588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7890843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 575 (I575N)

Ref Sequence

ENSEMBL: ENSMUSP00000052020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052678]

AlphaFold

Q80X90

Predicted Effect

probably benign
Transcript: ENSMUST00000052678
AA Change: I575N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: I575N

Domain	Start	End	E-Value	Type
CH	18	120	2.38e-26	SMART
CH	141	237	1.83e-18	SMART
IG_FLMN	253	350	1.17e-33	SMART
IG_FLMN	353	449	2.08e-34	SMART
IG_FLMN	451	546	3.42e-35	SMART
IG_FLMN	548	639	6.06e-27	SMART
IG_FLMN	644	739	1.94e-34	SMART
IG_FLMN	741	842	4.25e-31	SMART
IG_FLMN	844	941	5.16e-30	SMART
IG_FLMN	943	1037	5.12e-25	SMART
IG_FLMN	1039	1130	5.31e-41	SMART
IG_FLMN	1132	1225	1.4e-31	SMART
IG_FLMN	1227	1325	1.42e-32	SMART
IG_FLMN	1327	1418	5.19e-35	SMART
IG_FLMN	1420	1514	2.48e-41	SMART
IG_FLMN	1516	1611	3.15e-34	SMART
IG_FLMN	1613	1707	4.99e-37	SMART
IG_FLMN	1730	1819	4.44e-11	SMART
IG_FLMN	1820	1911	5.82e-38	SMART
IG_FLMN	1914	1997	5.68e-9	SMART
IG_FLMN	2001	2092	4.45e-34	SMART
IG_FLMN	2101	2188	1.24e-9	SMART
IG_FLMN	2192	2283	4.48e-39	SMART
IG_FLMN	2286	2378	2.94e-25	SMART
IG_FLMN	2383	2474	5.66e-27	SMART
IG_FLMN	2511	2602	1.63e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228206

Meta Mutation Damage Score

0.1302

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930444G20Rik	T	A	10: 22,066,843	T413S	possibly damaging	Het
4932438A13Rik	A	T	3: 36,917,677	T520S	probably benign	Het
Adamts16	A	T	13: 70,836,375	Y56*	probably null	Het
Ak2	T	A	4: 129,008,247	F238I	probably damaging	Het
Akap8l	T	C	17: 32,338,292	Y115C	probably damaging	Het
Alms1	A	G	6: 85,696,771	D3116G	probably damaging	Het
Arhgap24	T	G	5: 102,846,171		probably null	Het
Arhgap45	A	G	10: 80,025,476	E491G	probably damaging	Het
Atp8b1	C	T	18: 64,581,923	C86Y	probably damaging	Het
Atxn1	T	C	13: 45,557,377	K693R	probably benign	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
Btbd10	T	C	7: 113,332,724	K165R	probably damaging	Het
Capn11	C	T	17: 45,639,674	R293Q	possibly damaging	Het
Chordc1	T	G	9: 18,295,332	F33V	probably damaging	Het
Clca4b	G	A	3: 144,921,863	T449I	probably benign	Het
Clip4	A	C	17: 71,789,883	M1L	probably damaging	Het
Cyfip1	C	T	7: 55,873,730	T90I	probably benign	Het
Cyp4v3	G	T	8: 45,308,535	T417K	possibly damaging	Het
D430042O09Rik	T	A	7: 125,843,455		probably null	Het
Exoc3l4	T	C	12: 111,423,417	I142T	probably damaging	Het
Foxa1	A	T	12: 57,542,295	S380T	probably benign	Het
Foxi2	A	T	7: 135,410,939		probably null	Het
Gad1-ps	A	T	10: 99,444,533		noncoding transcript	Het
Gpa33	A	G	1: 166,146,791	T66A	possibly damaging	Het
Gpr45	A	G	1: 43,033,058	Y287C	probably damaging	Het
H2-Eb1	C	A	17: 34,314,255	Y150*	probably null	Het
H2-Ke6	T	C	17: 34,026,461	D233G	probably null	Het
Ifna6	A	T	4: 88,827,669	Q85L	probably damaging	Het
Ivns1abp	G	T	1: 151,354,009	L149F	probably benign	Het
Kank4	A	G	4: 98,765,461		probably null	Het
Lama2	A	T	10: 27,190,544	C1114S	probably damaging	Het
Lmbr1l	A	C	15: 98,907,608	D337E	possibly damaging	Het
Lrrn3	A	C	12: 41,452,298	S673R	possibly damaging	Het
Ly75	T	C	2: 60,308,311	D1404G	probably damaging	Het
Muc4	A	G	16: 32,753,720	T1199A	probably benign	Het
Mycn	A	T	12: 12,940,044	M117K	possibly damaging	Het
Nalcn	A	G	14: 123,295,406	I1314T	probably damaging	Het
Nod1	T	C	6: 54,933,576	T869A	probably benign	Het
Olfr1285	C	T	2: 111,408,473		noncoding transcript	Het
Olfr1388	T	C	11: 49,444,313	V154A	probably benign	Het
Plekhg2	A	T	7: 28,367,639	I356N	probably damaging	Het
Ptpru	T	A	4: 131,820,190	Y112F	possibly damaging	Het
Rpl36al	G	A	12: 69,183,123	P5L	possibly damaging	Het
Ryr2	A	G	13: 11,759,836	W1145R	probably damaging	Het
Slc11a2	A	G	15: 100,403,288	Y295H	probably damaging	Het
Slc22a6	A	G	19: 8,621,784		probably null	Het
Styxl1	A	G	5: 135,757,123		probably null	Het
Tmc6	A	G	11: 117,775,615	S288P	possibly damaging	Het
Trpv4	A	G	5: 114,634,556	L371P	probably damaging	Het
Usp8	A	G	2: 126,742,425	D518G	probably benign	Het
Washc4	T	C	10: 83,570,028	S463P	probably damaging	Het

Other mutations in Flnb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Flnb	APN	14	7917390	splice site	probably benign
IGL01063:Flnb	APN	14	7926518	splice site	probably benign
IGL01135:Flnb	APN	14	7909736	missense	probably benign
IGL01139:Flnb	APN	14	7945989	missense	probably damaging	1.00
IGL01364:Flnb	APN	14	7934562	critical splice acceptor site	probably null
IGL01417:Flnb	APN	14	7905513	missense	probably damaging	0.99
IGL01505:Flnb	APN	14	7902003	critical splice donor site	probably null
IGL01560:Flnb	APN	14	7893829	missense	probably benign	0.07
IGL01621:Flnb	APN	14	7950470	missense	probably damaging	1.00
IGL01656:Flnb	APN	14	7902010	splice site	probably benign
IGL01889:Flnb	APN	14	7935967	missense	possibly damaging	0.85
IGL01987:Flnb	APN	14	7922748	critical splice donor site	probably null
IGL02322:Flnb	APN	14	7894676	missense	probably damaging	1.00
IGL02496:Flnb	APN	14	7930919	splice site	probably benign
IGL02752:Flnb	APN	14	7917338	missense	probably benign
IGL03001:Flnb	APN	14	7934680	missense	probably damaging	0.99
IGL03076:Flnb	APN	14	7901988	missense	probably benign	0.01
IGL03085:Flnb	APN	14	7882211	missense	probably benign
IGL03170:Flnb	APN	14	7818261	missense	possibly damaging	0.90
IGL03373:Flnb	APN	14	7890867	critical splice donor site	probably null
Boomerang	UTSW	14	7901945	missense	probably damaging	1.00
Queensland	UTSW	14	7927352	missense	probably damaging	1.00
R3437_Flnb_252	UTSW	14	7942057	missense	probably damaging	0.97
R8441_Flnb_221	UTSW	14	7896488	missense	probably benign	0.15
Rhodelinda	UTSW	14	7887682	splice site	probably benign
saul	UTSW	14	7889183	missense	probably damaging	0.99
Xerxes	UTSW	14	7867551	missense	probably damaging	1.00
R0068:Flnb	UTSW	14	7915290	missense	possibly damaging	0.49
R0068:Flnb	UTSW	14	7915290	missense	possibly damaging	0.49
R0084:Flnb	UTSW	14	7935979	missense	probably benign
R0128:Flnb	UTSW	14	7901951	missense	probably damaging	0.99
R0130:Flnb	UTSW	14	7901951	missense	probably damaging	0.99
R0148:Flnb	UTSW	14	7939077	missense	probably benign	0.01
R0166:Flnb	UTSW	14	7896115	missense	probably damaging	1.00
R0376:Flnb	UTSW	14	7946014	critical splice donor site	probably null
R0547:Flnb	UTSW	14	7912943	splice site	probably null
R0612:Flnb	UTSW	14	7887682	splice site	probably benign
R0656:Flnb	UTSW	14	7927352	missense	probably damaging	1.00
R0691:Flnb	UTSW	14	7890810	missense	probably benign	0.16
R1241:Flnb	UTSW	14	7896503	missense	probably benign	0.06
R1572:Flnb	UTSW	14	7883908	missense	probably damaging	0.97
R1682:Flnb	UTSW	14	7913121	missense	probably benign	0.04
R1807:Flnb	UTSW	14	7934645	missense	probably benign	0.26
R1848:Flnb	UTSW	14	7892113	missense	probably damaging	1.00
R1959:Flnb	UTSW	14	7884735	nonsense	probably null
R2078:Flnb	UTSW	14	7927466	missense	probably damaging	1.00
R2132:Flnb	UTSW	14	7873376	missense	probably benign	0.04
R2209:Flnb	UTSW	14	7905507	nonsense	probably null
R2212:Flnb	UTSW	14	7881652	small deletion	probably benign
R2213:Flnb	UTSW	14	7881652	small deletion	probably benign
R2363:Flnb	UTSW	14	7945950	missense	possibly damaging	0.95
R2415:Flnb	UTSW	14	7929932	missense	probably benign	0.07
R2983:Flnb	UTSW	14	7882250	missense	probably damaging	1.00
R3001:Flnb	UTSW	14	7907162	missense	probably benign	0.22
R3002:Flnb	UTSW	14	7907162	missense	probably benign	0.22
R3436:Flnb	UTSW	14	7942057	missense	probably damaging	0.97
R3437:Flnb	UTSW	14	7942057	missense	probably damaging	0.97
R3778:Flnb	UTSW	14	7915353	missense	probably benign	0.06
R3783:Flnb	UTSW	14	7889236	missense	probably benign	0.04
R4162:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4163:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4164:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4356:Flnb	UTSW	14	7922700	missense	probably benign
R4369:Flnb	UTSW	14	7942216	missense	probably benign
R4783:Flnb	UTSW	14	7905701	missense	probably benign	0.12
R4785:Flnb	UTSW	14	7905701	missense	probably benign	0.12
R4790:Flnb	UTSW	14	7905661	missense	probably benign	0.34
R4828:Flnb	UTSW	14	7919238	missense	probably benign	0.13
R4882:Flnb	UTSW	14	7929936	missense	possibly damaging	0.56
R5002:Flnb	UTSW	14	7945882	missense	probably damaging	1.00
R5058:Flnb	UTSW	14	7924262	nonsense	probably null
R5184:Flnb	UTSW	14	7901945	missense	probably damaging	1.00
R5186:Flnb	UTSW	14	7909748	missense	probably damaging	1.00
R5395:Flnb	UTSW	14	7883881	missense	probably benign	0.02
R5421:Flnb	UTSW	14	7926494	missense	probably damaging	1.00
R5671:Flnb	UTSW	14	7890843	missense	probably benign	0.00
R5714:Flnb	UTSW	14	7929073	missense	probably damaging	1.00
R5860:Flnb	UTSW	14	7931135	missense	probably damaging	1.00
R5892:Flnb	UTSW	14	7907183	missense	probably damaging	1.00
R5924:Flnb	UTSW	14	7890765	missense	probably benign	0.00
R6131:Flnb	UTSW	14	7894635	missense	possibly damaging	0.79
R6244:Flnb	UTSW	14	7892092	missense	probably damaging	1.00
R6489:Flnb	UTSW	14	7867551	missense	probably damaging	1.00
R6582:Flnb	UTSW	14	7892275	critical splice donor site	probably null
R6586:Flnb	UTSW	14	7929138	missense	possibly damaging	0.93
R6611:Flnb	UTSW	14	7915318	missense	probably damaging	1.00
R6626:Flnb	UTSW	14	7929012	missense	probably damaging	1.00
R6700:Flnb	UTSW	14	7892189	missense	probably damaging	0.99
R6738:Flnb	UTSW	14	7904536	missense	probably benign	0.01
R6864:Flnb	UTSW	14	7905640	missense	possibly damaging	0.84
R6916:Flnb	UTSW	14	7907171	missense	probably damaging	0.99
R7117:Flnb	UTSW	14	7894214	missense	probably benign	0.02
R7164:Flnb	UTSW	14	7915944	splice site	probably null
R7328:Flnb	UTSW	14	7883788	missense	possibly damaging	0.95
R7328:Flnb	UTSW	14	7894660	nonsense	probably null
R7687:Flnb	UTSW	14	7924224	missense	probably damaging	1.00
R7716:Flnb	UTSW	14	7917274	missense	possibly damaging	0.64
R7763:Flnb	UTSW	14	7926478	missense	probably benign	0.00
R7821:Flnb	UTSW	14	7939113	missense	probably benign	0.00
R7921:Flnb	UTSW	14	7933800	missense	possibly damaging	0.57
R8008:Flnb	UTSW	14	7892155	missense	probably damaging	1.00
R8075:Flnb	UTSW	14	7913048	missense	probably benign	0.00
R8084:Flnb	UTSW	14	7907243	missense	probably benign	0.00
R8259:Flnb	UTSW	14	7889183	missense	probably damaging	0.99
R8441:Flnb	UTSW	14	7896488	missense	probably benign	0.15
R8493:Flnb	UTSW	14	7869822	missense	probably damaging	0.97
R8508:Flnb	UTSW	14	7950394	missense	probably damaging	0.98
R8531:Flnb	UTSW	14	7929939	missense	probably damaging	1.00
R8812:Flnb	UTSW	14	7887624	missense	probably benign	0.06
R8814:Flnb	UTSW	14	7927409	missense	probably damaging	1.00
R8825:Flnb	UTSW	14	7887566	missense	probably damaging	1.00
R8868:Flnb	UTSW	14	7908671	missense	probably benign	0.02
R8955:Flnb	UTSW	14	7892874	missense	probably damaging	1.00
R8955:Flnb	UTSW	14	7904688	nonsense	probably null
R8976:Flnb	UTSW	14	7901882	critical splice acceptor site	probably null
R9055:Flnb	UTSW	14	7908553	missense	probably benign	0.00
R9148:Flnb	UTSW	14	7817996	start gained	probably benign
R9179:Flnb	UTSW	14	7887541	nonsense	probably null
R9180:Flnb	UTSW	14	7818219	missense	probably damaging	1.00
R9189:Flnb	UTSW	14	7892976	missense	possibly damaging	0.90
R9286:Flnb	UTSW	14	7873414	missense	probably damaging	0.98
R9288:Flnb	UTSW	14	7904498	missense	probably benign	0.43
R9354:Flnb	UTSW	14	7818411	missense	probably benign	0.13
R9484:Flnb	UTSW	14	7929004	missense	probably benign	0.06
R9505:Flnb	UTSW	14	7904665	missense	probably benign
R9525:Flnb	UTSW	14	7905481	missense	probably damaging	1.00
R9621:Flnb	UTSW	14	7926421	missense	probably damaging	0.99
R9630:Flnb	UTSW	14	7926438	nonsense	probably null
R9739:Flnb	UTSW	14	7935954	nonsense	probably null
R9760:Flnb	UTSW	14	7929846	missense	probably damaging	0.98
X0066:Flnb	UTSW	14	7908636	missense	probably damaging	1.00
Z1088:Flnb	UTSW	14	7905871	missense	probably benign	0.04
Z1176:Flnb	UTSW	14	7942066	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TCTGTACAAAAGATCAGGCAAGTG -3'
(R):5'- TGTCACAGGCATTGGACAAC -3'

Sequencing Primer
(F):5'- AGTGGAAAGAGTTATGTTAAGAGTTC -3'
(R):5'- TCACAGGCATTGGACAACTGAAAG -3'

Posted On

2016-11-09