Incidental Mutation 'H8786:Aars'
ID44451
Institutional Source Beutler Lab
Gene Symbol Aars
Ensembl Gene ENSMUSG00000031960
Gene Namealanyl-tRNA synthetase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111033144-111057664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111045555 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: D459G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: D459G

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174930
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Aars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars APN 8 111047972 missense possibly damaging 0.86
IGL00731:Aars APN 8 111044869 splice site probably benign
IGL00826:Aars APN 8 111040300 missense probably damaging 1.00
IGL01521:Aars APN 8 111043787 missense possibly damaging 0.85
IGL01885:Aars APN 8 111047943 missense possibly damaging 0.89
IGL01920:Aars APN 8 111043246 missense probably damaging 1.00
IGL01934:Aars APN 8 111048018 missense probably damaging 0.98
IGL02013:Aars APN 8 111047066 missense probably damaging 0.99
IGL02489:Aars APN 8 111054215 unclassified probably benign
IGL02683:Aars APN 8 111052531 unclassified probably benign
IGL03084:Aars APN 8 111041629 missense probably damaging 1.00
R0037:Aars UTSW 8 111043259 missense possibly damaging 0.77
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0577:Aars UTSW 8 111043278 missense probably benign 0.10
R1183:Aars UTSW 8 111041574 nonsense probably null
R1642:Aars UTSW 8 111043250 missense possibly damaging 0.77
R1829:Aars UTSW 8 111042706 missense probably damaging 1.00
R1857:Aars UTSW 8 111040157 missense probably damaging 0.99
R2190:Aars UTSW 8 111040153 missense probably damaging 1.00
R2303:Aars UTSW 8 111052502 missense possibly damaging 0.84
R3918:Aars UTSW 8 111040142 missense probably damaging 1.00
R4001:Aars UTSW 8 111041602 missense probably damaging 1.00
R4434:Aars UTSW 8 111054621 missense probably null 0.74
R4909:Aars UTSW 8 111055083 missense probably damaging 1.00
R4970:Aars UTSW 8 111043679 missense probably benign 0.00
R5639:Aars UTSW 8 111043234 missense probably benign 0.01
R5991:Aars UTSW 8 111050400 missense probably damaging 1.00
R6403:Aars UTSW 8 111042249 missense possibly damaging 0.87
R6521:Aars UTSW 8 111043336 missense probably benign 0.01
R6956:Aars UTSW 8 111055130 missense probably benign 0.38
R7378:Aars UTSW 8 111042342 missense probably damaging 1.00
R7625:Aars UTSW 8 111046955 missense probably damaging 0.99
R7745:Aars UTSW 8 111041657 missense probably damaging 1.00
R7792:Aars UTSW 8 111043264 missense possibly damaging 0.75
R7860:Aars UTSW 8 111049861 missense probably benign 0.16
R7943:Aars UTSW 8 111049861 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACCAGGCAACTGGATTCCCTTC -3'
(R):5'- GCTCCCCAGATAGAAAGGCAGACAG -3'

Sequencing Primer
(F):5'- atgaaagaagacagccccc -3'
(R):5'- CAGACAGCGTGGGAGCAG -3'
Posted On2013-06-11