Mutagenetix > Incidental Mutation

Incidental Mutation 'R4950:Tbx15'

444516

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

042547-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99326384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 288 (I288V)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: I288V

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I288V

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.3927

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	T	2: 154,311,659	D215V	probably damaging	Het
Cacna1i	A	G	15: 80,368,671	E625G	probably damaging	Het
Cage1	C	T	13: 38,023,326	S181N	possibly damaging	Het
Ccdc36	A	C	9: 108,421,510	S36R	probably damaging	Het
Ccdc73	A	C	2: 104,992,366	I887L	probably benign	Het
Cfap65	T	A	1: 74,906,336	K1408*	probably null	Het
Cngb1	C	A	8: 95,248,507	G654W	probably damaging	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Ddi1	A	G	9: 6,266,073	S99P	probably benign	Het
Disp3	A	T	4: 148,258,126	D622E	possibly damaging	Het
Dnajc22	G	A	15: 99,101,734	V267I	probably benign	Het
Dph5	G	A	3: 115,928,643	G257S	probably benign	Het
Elmo2	A	T	2: 165,314,813		probably null	Het
Fam186a	T	C	15: 99,941,653	R2237G	unknown	Het
Fez1	G	A	9: 36,867,882	R285Q	probably damaging	Het
Fsip2	A	T	2: 82,946,932	H101L	probably damaging	Het
Fsip2	G	A	2: 82,977,414	C1359Y	probably benign	Het
Fxyd7	G	A	7: 31,047,390	T15I	probably benign	Het
Gpr155	A	T	2: 73,382,185	D31E	probably benign	Het
Irx6	A	T	8: 92,678,800	Y432F	probably damaging	Het
Itih5	A	C	2: 10,235,081	I340L	probably damaging	Het
Lao1	T	C	4: 118,965,375	L164S	probably damaging	Het
Mcoln3	T	C	3: 146,139,519	I490T	probably damaging	Het
Mef2b	T	C	8: 70,167,196	Y311H	probably damaging	Het
Mras	A	T	9: 99,394,484	L111Q	probably damaging	Het
Mrc1	A	G	2: 14,271,280	D475G	probably damaging	Het
Nrcam	T	C	12: 44,598,490	I1155T	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Olfr58	G	A	9: 19,783,731	M199I	probably benign	Het
Olfr885	T	C	9: 38,062,001	I227T	probably damaging	Het
Parp9	A	T	16: 35,948,007	I186F	probably damaging	Het
Pcdhac2	T	A	18: 37,145,230	V421E	probably benign	Het
Pck1	T	A	2: 173,154,827	I178K	probably benign	Het
Pde6b	A	G	5: 108,430,703	K836E	probably benign	Het
Ptprd	T	A	4: 76,140,515		probably null	Het
Pwp2	A	G	10: 78,183,006	Y56H	probably benign	Het
Rarb	G	A	14: 16,432,085		probably benign	Het
Rpain	C	G	11: 70,970,921	H50Q	probably benign	Het
Rps9	CTGTTTG	CTG	7: 3,704,759		probably null	Het
Rubcn	A	T	16: 32,843,193	S358T	probably damaging	Het
Ryr2	G	A	13: 11,742,011	R1586C	probably damaging	Het
Slfn9	T	C	11: 82,981,904	I669V	probably benign	Het
Slx1b	T	C	7: 126,691,767		probably benign	Het
Spsb3	T	A	17: 24,887,511		probably benign	Het
Tlr2	C	A	3: 83,837,332	E481D	probably damaging	Het
Trim17	A	T	11: 58,970,428	D253V	probably damaging	Het
Trim69	A	G	2: 122,178,746	D429G	probably damaging	Het
Vstm5	A	G	9: 15,257,794		probably null	Het
Vwa3b	A	G	1: 37,085,332	Q337R	probably benign	Het
Zfp113	T	C	5: 138,145,472	N172S	probably benign	Het
Zfp607a	T	A	7: 27,878,751	H415Q	probably damaging	Het
Zfp87	G	A	13: 67,517,899	T148I	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAACCCTGGATGTCAGAAGG -3'
(R):5'- TCTGAGTCAGTGCAGTTGC -3'

Sequencing Primer
(F):5'- AGTTACACATCTGGGTGCC -3'
(R):5'- GCAGTTGCAGAGTTACAAGCATTC -3'

Posted On

2016-11-11