Incidental Mutation 'R4950:Tbx15'
ID 444516
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99233700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 288 (I288V)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: I288V

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I288V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.3927 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACCCTGGATGTCAGAAGG -3'
(R):5'- TCTGAGTCAGTGCAGTTGC -3'

Sequencing Primer
(F):5'- AGTTACACATCTGGGTGCC -3'
(R):5'- GCAGTTGCAGAGTTACAAGCATTC -3'
Posted On 2016-11-11