Incidental Mutation 'R4950:Tbx15'
List |< first << previous [record 45 of 53] next >> last >|
ID444516
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene NameT-box 15
Synonymsde, Tbx14, Tbx8
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location99240381-99354259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99326384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 288 (I288V)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: I288V

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I288V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.3927 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
Shortcut UTSW 3 99313073 nonsense probably null
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99351912 missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 splice site probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99253893 intron probably benign
R3118:Tbx15 UTSW 3 99352154 missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6173:Tbx15 UTSW 3 99253887 nonsense probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99253938 missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99352570 missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99351989 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACCCTGGATGTCAGAAGG -3'
(R):5'- TCTGAGTCAGTGCAGTTGC -3'

Sequencing Primer
(F):5'- AGTTACACATCTGGGTGCC -3'
(R):5'- GCAGTTGCAGAGTTACAAGCATTC -3'
Posted On2016-11-11