Mutagenetix > Incidental Mutations

Incidental Mutation 'R4950:Trim17'

444517

Institutional Source

Beutler Lab

Gene Symbol

Trim17

Ensembl Gene

ENSMUSG00000036964

Gene Name

tripartite motif-containing 17

Synonyms

terf, Rnf16

MMRRC Submission

042547-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58954685-58973098 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58970428 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 253 (D253V)

Ref Sequence

ENSEMBL: ENSMUSP00000037248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047697
AA Change: D253V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: D253V

Domain	Start	End	E-Value	Type
RING	16	65	1.17e-10	SMART
BBOX	94	135	4.1e-15	SMART
coiled coil region	143	180	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075141
AA Change: D253V

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: D253V

Domain	Start	End	E-Value	Type
RING	16	65	1.17e-10	SMART
BBOX	94	135	4.1e-15	SMART
coiled coil region	143	180	N/A	INTRINSIC
PRY	294	347	8.95e-16	SMART
SPRY	348	472	2.54e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131221

Meta Mutation Damage Score

0.2207

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	T	2: 154,311,659	D215V	probably damaging	Het
Cacna1i	A	G	15: 80,368,671	E625G	probably damaging	Het
Cage1	C	T	13: 38,023,326	S181N	possibly damaging	Het
Ccdc36	A	C	9: 108,421,510	S36R	probably damaging	Het
Ccdc73	A	C	2: 104,992,366	I887L	probably benign	Het
Cfap65	T	A	1: 74,906,336	K1408*	probably null	Het
Cngb1	C	A	8: 95,248,507	G654W	probably damaging	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Ddi1	A	G	9: 6,266,073	S99P	probably benign	Het
Disp3	A	T	4: 148,258,126	D622E	possibly damaging	Het
Dnajc22	G	A	15: 99,101,734	V267I	probably benign	Het
Dph5	G	A	3: 115,928,643	G257S	probably benign	Het
Elmo2	A	T	2: 165,314,813		probably null	Het
Fam186a	T	C	15: 99,941,653	R2237G	unknown	Het
Fez1	G	A	9: 36,867,882	R285Q	probably damaging	Het
Fsip2	A	T	2: 82,946,932	H101L	probably damaging	Het
Fsip2	G	A	2: 82,977,414	C1359Y	probably benign	Het
Fxyd7	G	A	7: 31,047,390	T15I	probably benign	Het
Gpr155	A	T	2: 73,382,185	D31E	probably benign	Het
Irx6	A	T	8: 92,678,800	Y432F	probably damaging	Het
Itih5	A	C	2: 10,235,081	I340L	probably damaging	Het
Lao1	T	C	4: 118,965,375	L164S	probably damaging	Het
Mcoln3	T	C	3: 146,139,519	I490T	probably damaging	Het
Mef2b	T	C	8: 70,167,196	Y311H	probably damaging	Het
Mras	A	T	9: 99,394,484	L111Q	probably damaging	Het
Mrc1	A	G	2: 14,271,280	D475G	probably damaging	Het
Nrcam	T	C	12: 44,598,490	I1155T	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Olfr58	G	A	9: 19,783,731	M199I	probably benign	Het
Olfr885	T	C	9: 38,062,001	I227T	probably damaging	Het
Parp9	A	T	16: 35,948,007	I186F	probably damaging	Het
Pcdhac2	T	A	18: 37,145,230	V421E	probably benign	Het
Pck1	T	A	2: 173,154,827	I178K	probably benign	Het
Pde6b	A	G	5: 108,430,703	K836E	probably benign	Het
Ptprd	T	A	4: 76,140,515		probably null	Het
Pwp2	A	G	10: 78,183,006	Y56H	probably benign	Het
Rarb	G	A	14: 16,432,085		probably benign	Het
Rpain	C	G	11: 70,970,921	H50Q	probably benign	Het
Rps9	CTGTTTG	CTG	7: 3,704,759		probably null	Het
Rubcn	A	T	16: 32,843,193	S358T	probably damaging	Het
Ryr2	G	A	13: 11,742,011	R1586C	probably damaging	Het
Slfn9	T	C	11: 82,981,904	I669V	probably benign	Het
Slx1b	T	C	7: 126,691,767		probably benign	Het
Spsb3	T	A	17: 24,887,511		probably benign	Het
Tbx15	A	G	3: 99,326,384	I288V	possibly damaging	Het
Tlr2	C	A	3: 83,837,332	E481D	probably damaging	Het
Trim69	A	G	2: 122,178,746	D429G	probably damaging	Het
Vstm5	A	G	9: 15,257,794		probably null	Het
Vwa3b	A	G	1: 37,085,332	Q337R	probably benign	Het
Zfp113	T	C	5: 138,145,472	N172S	probably benign	Het
Zfp607a	T	A	7: 27,878,751	H415Q	probably damaging	Het
Zfp87	G	A	13: 67,517,899	T148I	probably benign	Het

Other mutations in Trim17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Trim17	APN	11	58970597	missense	probably damaging	1.00
IGL02581:Trim17	APN	11	58971076	nonsense	probably null
P0026:Trim17	UTSW	11	58971258	missense	possibly damaging	0.83
R0518:Trim17	UTSW	11	58968494	missense	probably damaging	0.99
R0521:Trim17	UTSW	11	58968494	missense	probably damaging	0.99
R0765:Trim17	UTSW	11	58971369	missense	possibly damaging	0.73
R1165:Trim17	UTSW	11	58971215	missense	possibly damaging	0.92
R1441:Trim17	UTSW	11	58965192	missense	probably damaging	1.00
R2164:Trim17	UTSW	11	58971411	missense	probably damaging	1.00
R2320:Trim17	UTSW	11	58966798	missense	probably benign
R3436:Trim17	UTSW	11	58965233	missense	probably damaging	1.00
R4715:Trim17	UTSW	11	58968450	intron	probably benign
R4832:Trim17	UTSW	11	58971444	missense	probably damaging	0.97
R4928:Trim17	UTSW	11	58954301	unclassified	probably benign
R5339:Trim17	UTSW	11	58954510	splice site	probably null
R5909:Trim17	UTSW	11	58968680	missense	probably damaging	1.00
R5915:Trim17	UTSW	11	58968562	missense	probably damaging	0.99
R5947:Trim17	UTSW	11	58965543	missense	probably damaging	1.00
R6732:Trim17	UTSW	11	58971025	critical splice acceptor site	probably null
R7027:Trim17	UTSW	11	58968616	missense	probably benign	0.08
R7143:Trim17	UTSW	11	58965184	nonsense	probably null
R7168:Trim17	UTSW	11	58968578	missense	probably benign
R7682:Trim17	UTSW	11	58966808	missense	possibly damaging	0.82
R7707:Trim17	UTSW	11	58965284	nonsense	probably null
R7972:Trim17	UTSW	11	58968568	missense	probably benign	0.01
Z1177:Trim17	UTSW	11	58965389	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAATGCTTAGGGTCTGCCAAG -3'
(R):5'- TTACCTTGGAAGCTTTTGAGCAC -3'

Sequencing Primer
(F):5'- GCAGGAGTGAAAGGGAAGCTTC -3'
(R):5'- GAACTCTGCACAAGGTCTTGATAGC -3'

Posted On

2016-11-11