Incidental Mutation 'R4950:Trim17'
ID 444517
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Name tripartite motif-containing 17
Synonyms terf, Rnf16
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58954685-58973098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58970428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 253 (D253V)
Ref Sequence ENSEMBL: ENSMUSP00000037248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
AlphaFold Q7TPM3
Predicted Effect probably damaging
Transcript: ENSMUST00000047697
AA Change: D253V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: D253V

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075141
AA Change: D253V

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: D253V

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131221
Meta Mutation Damage Score 0.2207 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
R8543:Trim17 UTSW 11 58971455 missense probably damaging 1.00
R8791:Trim17 UTSW 11 58971176 missense probably benign 0.00
R8894:Trim17 UTSW 11 58968710 missense probably benign 0.00
R9015:Trim17 UTSW 11 58965231 missense probably damaging 0.99
R9026:Trim17 UTSW 11 58971447 missense probably benign 0.01
R9269:Trim17 UTSW 11 58971431 missense probably damaging 1.00
R9609:Trim17 UTSW 11 58965138 missense probably damaging 1.00
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Z1186:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1186:Trim17 UTSW 11 58970446 missense probably benign
Z1187:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1187:Trim17 UTSW 11 58970446 missense probably benign
Z1188:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1188:Trim17 UTSW 11 58970446 missense probably benign
Z1189:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1189:Trim17 UTSW 11 58970446 missense probably benign
Z1190:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1190:Trim17 UTSW 11 58970446 missense probably benign
Z1191:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1191:Trim17 UTSW 11 58970446 missense probably benign
Z1192:Trim17 UTSW 11 58965505 missense probably benign 0.00
Z1192:Trim17 UTSW 11 58970446 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAATGCTTAGGGTCTGCCAAG -3'
(R):5'- TTACCTTGGAAGCTTTTGAGCAC -3'

Sequencing Primer
(F):5'- GCAGGAGTGAAAGGGAAGCTTC -3'
(R):5'- GAACTCTGCACAAGGTCTTGATAGC -3'
Posted On 2016-11-11