Incidental Mutation 'R4928:Atp1a2'
ID 444518
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene Name ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms Atpa-3
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4928 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 172099276-172125631 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 172105954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 904 (T904A)
Ref Sequence ENSEMBL: ENSMUSP00000095072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
AlphaFold Q6PIE5
Predicted Effect possibly damaging
Transcript: ENSMUST00000085913
AA Change: T904A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: T904A

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097464
AA Change: T904A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: T904A

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191781
Meta Mutation Damage Score 0.5514 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Sod2 C T 17: 13,227,073 (GRCm39) T9M probably benign Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172,103,569 (GRCm39) missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172,118,201 (GRCm39) missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172,112,186 (GRCm39) missense probably benign
IGL01372:Atp1a2 APN 1 172,106,510 (GRCm39) missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172,112,480 (GRCm39) missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172,113,578 (GRCm39) missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172,113,876 (GRCm39) missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172,103,754 (GRCm39) missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172,107,298 (GRCm39) nonsense probably null
IGL02219:Atp1a2 APN 1 172,107,285 (GRCm39) missense probably damaging 1.00
IGL02304:Atp1a2 APN 1 172,116,920 (GRCm39) missense probably benign
IGL02507:Atp1a2 APN 1 172,113,338 (GRCm39) missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172,106,218 (GRCm39) missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172,108,181 (GRCm39) missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172,105,923 (GRCm39) missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172,120,934 (GRCm39) missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172,106,429 (GRCm39) intron probably benign
IGL03218:Atp1a2 APN 1 172,116,870 (GRCm39) missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172,118,288 (GRCm39) missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172,106,941 (GRCm39) missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172,116,909 (GRCm39) missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172,118,842 (GRCm39) missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172,112,164 (GRCm39) missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172,116,948 (GRCm39) missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172,106,911 (GRCm39) missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172,106,521 (GRCm39) missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172,115,000 (GRCm39) missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172,106,551 (GRCm39) missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172,106,204 (GRCm39) missense possibly damaging 0.75
R4953:Atp1a2 UTSW 1 172,119,009 (GRCm39) intron probably benign
R5014:Atp1a2 UTSW 1 172,112,438 (GRCm39) missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172,112,012 (GRCm39) intron probably benign
R5129:Atp1a2 UTSW 1 172,103,522 (GRCm39) missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172,106,436 (GRCm39) critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172,106,948 (GRCm39) missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172,118,994 (GRCm39) intron probably benign
R5718:Atp1a2 UTSW 1 172,107,009 (GRCm39) missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172,120,938 (GRCm39) missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172,114,797 (GRCm39) missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172,125,579 (GRCm39) intron probably benign
R6145:Atp1a2 UTSW 1 172,114,805 (GRCm39) missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172,106,459 (GRCm39) missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172,116,903 (GRCm39) missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172,116,903 (GRCm39) missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172,116,903 (GRCm39) missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172,116,903 (GRCm39) missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172,116,903 (GRCm39) missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172,116,942 (GRCm39) missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172,112,181 (GRCm39) missense probably benign
R6812:Atp1a2 UTSW 1 172,112,444 (GRCm39) missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172,112,117 (GRCm39) nonsense probably null
R7194:Atp1a2 UTSW 1 172,108,194 (GRCm39) nonsense probably null
R7459:Atp1a2 UTSW 1 172,114,862 (GRCm39) missense probably benign 0.00
R7791:Atp1a2 UTSW 1 172,103,782 (GRCm39) missense probably benign 0.28
R7889:Atp1a2 UTSW 1 172,105,631 (GRCm39) splice site probably null
R7993:Atp1a2 UTSW 1 172,118,878 (GRCm39) missense possibly damaging 0.86
R8183:Atp1a2 UTSW 1 172,116,918 (GRCm39) missense probably damaging 0.96
R8434:Atp1a2 UTSW 1 172,112,179 (GRCm39) missense probably benign 0.01
R8712:Atp1a2 UTSW 1 172,103,547 (GRCm39) missense probably benign 0.05
R8724:Atp1a2 UTSW 1 172,106,945 (GRCm39) missense probably benign 0.13
R8887:Atp1a2 UTSW 1 172,113,222 (GRCm39) missense probably null 0.02
R8965:Atp1a2 UTSW 1 172,107,612 (GRCm39) missense probably benign 0.25
R9322:Atp1a2 UTSW 1 172,107,625 (GRCm39) missense possibly damaging 0.94
R9383:Atp1a2 UTSW 1 172,107,334 (GRCm39) missense probably benign
R9451:Atp1a2 UTSW 1 172,103,494 (GRCm39) missense probably benign
R9485:Atp1a2 UTSW 1 172,105,822 (GRCm39) makesense probably null
R9727:Atp1a2 UTSW 1 172,118,936 (GRCm39) missense probably benign 0.01
Z1176:Atp1a2 UTSW 1 172,107,321 (GRCm39) missense possibly damaging 0.90
Z1177:Atp1a2 UTSW 1 172,114,903 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATCCTGGCCTATGTGG -3'
(R):5'- ATCGGACTACCAACGACCTG -3'

Sequencing Primer
(F):5'- GTGACTATGTACAGAGGCCTC -3'
(R):5'- CGACCTGGAGGACAGCTATG -3'
Posted On 2016-11-11