Incidental Mutation 'R4928:Sod2'
ID 444526
Institutional Source Beutler Lab
Gene Symbol Sod2
Ensembl Gene ENSMUSG00000006818
Gene Name superoxide dismutase 2, mitochondrial
Synonyms Sod-2, manganese superoxide dismutase, manganese SOD, MnSOD
MMRRC Submission 042529-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4928 (G1)
Quality Score 177
Status Validated
Chromosome 17
Chromosomal Location 13226726-13237006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 13227073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 9 (T9M)
Ref Sequence ENSEMBL: ENSMUSP00000007012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007012]
AlphaFold P09671
Predicted Effect probably benign
Transcript: ENSMUST00000007012
AA Change: T9M

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000007012
Gene: ENSMUSG00000006818
AA Change: T9M

DomainStartEndE-ValueType
Pfam:Sod_Fe_N 25 106 1e-34 PFAM
Pfam:Sod_Fe_C 113 216 8.1e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mutations affect mitochondrial function. Null homozygotes die early with cardiomyopathy, tissue lipid accumulation, neurodegeneration, motor problems and/or metabolic acidosis depending on strain background. Heterozygotes show mitochondria and apoptosis defects with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530021J07Rik G T 7: 82,805,086 (GRCm39) noncoding transcript Het
Aasdh T A 5: 77,044,535 (GRCm39) K118N possibly damaging Het
Abca14 A T 7: 119,923,803 (GRCm39) N1620I possibly damaging Het
Acap1 A T 11: 69,776,641 (GRCm39) S149T possibly damaging Het
Adgre1 T A 17: 57,751,064 (GRCm39) Y579* probably null Het
Aifm3 T C 16: 17,318,296 (GRCm39) probably benign Het
Aldh16a1 A G 7: 44,791,385 (GRCm39) W107R probably damaging Het
Amer2 A T 14: 60,616,894 (GRCm39) H363L possibly damaging Het
Arhgap10 A G 8: 78,152,957 (GRCm39) probably null Het
Arhgef6 A T X: 56,280,238 (GRCm39) D742E probably damaging Het
Astn2 A T 4: 65,647,644 (GRCm39) N731K probably damaging Het
Atp1a2 T C 1: 172,105,954 (GRCm39) T904A possibly damaging Het
Atr C T 9: 95,789,352 (GRCm39) R1503W probably damaging Het
Cdh3 G T 8: 107,263,242 (GRCm39) R97L probably benign Het
Chst2 C T 9: 95,288,059 (GRCm39) V96I probably benign Het
Cit T A 5: 116,123,856 (GRCm39) N1464K probably benign Het
Col17a1 A T 19: 47,658,897 (GRCm39) probably null Het
Col4a3 G A 1: 82,688,698 (GRCm39) probably benign Het
Copz1 T A 15: 103,199,757 (GRCm39) S57R probably damaging Het
Cpped1 A T 16: 11,646,143 (GRCm39) F227Y probably damaging Het
Cyp2j12 A T 4: 95,990,388 (GRCm39) probably null Het
Dctn1 T A 6: 83,166,189 (GRCm39) I195N possibly damaging Het
Dhrs7b A G 11: 60,742,751 (GRCm39) I148V probably benign Het
Dnah17 T C 11: 117,918,259 (GRCm39) D4096G probably damaging Het
Dnajc13 T C 9: 104,110,837 (GRCm39) N145D possibly damaging Het
Ecpas A G 4: 58,827,073 (GRCm39) V1020A probably damaging Het
Entrep2 G T 7: 64,409,116 (GRCm39) S426* probably null Het
Ercc6l2 T C 13: 64,042,627 (GRCm39) probably benign Het
Fads6 T G 11: 115,187,387 (GRCm39) I103L probably benign Het
Fat4 T G 3: 39,064,614 (GRCm39) Y4857D probably damaging Het
Fbxl14 T A 6: 119,457,671 (GRCm39) L284Q probably damaging Het
Fkbp9 T C 6: 56,826,655 (GRCm39) V85A possibly damaging Het
Galnt13 T A 2: 54,406,577 (GRCm39) V9E probably damaging Het
Gm14412 A T 2: 177,006,373 (GRCm39) S507R probably benign Het
Gm15142 T A X: 153,421,415 (GRCm39) noncoding transcript Het
Gm4787 T C 12: 81,425,612 (GRCm39) E182G probably benign Het
Gm6811 C A 17: 21,314,893 (GRCm39) noncoding transcript Het
Gm9791 A T 3: 34,059,218 (GRCm39) noncoding transcript Het
Hoxb7 A T 11: 96,180,336 (GRCm39) probably null Het
Ift122 T A 6: 115,892,819 (GRCm39) probably benign Het
Krt28 C T 11: 99,265,458 (GRCm39) V70I probably benign Het
Lig1 T C 7: 13,032,664 (GRCm39) S459P probably damaging Het
Lrfn3 C T 7: 30,060,048 (GRCm39) R59H possibly damaging Het
Mavs T C 2: 131,088,663 (GRCm39) V489A probably benign Het
Mcm8 C T 2: 132,681,399 (GRCm39) P625L probably benign Het
Megf10 G T 18: 57,373,745 (GRCm39) R181L probably benign Het
Mgrn1 G A 16: 4,745,726 (GRCm39) G440D probably benign Het
Mllt3 T C 4: 87,700,642 (GRCm39) probably null Het
Muc5ac T A 7: 141,371,639 (GRCm39) Y2613* probably null Het
Myh14 C T 7: 44,284,926 (GRCm39) G662S probably benign Het
Myod1 T A 7: 46,026,474 (GRCm39) N126K probably damaging Het
Nae1 A T 8: 105,242,774 (GRCm39) H439Q possibly damaging Het
Narf T A 11: 121,135,765 (GRCm39) V136E possibly damaging Het
Ncapd3 T A 9: 26,983,031 (GRCm39) C926* probably null Het
Ndufv2 C A 17: 66,399,653 (GRCm39) probably null Het
Neb T C 2: 52,102,987 (GRCm39) S449G possibly damaging Het
Nek10 C T 14: 14,930,577 (GRCm38) P698L probably damaging Het
Nox3 T A 17: 3,685,550 (GRCm39) E566V probably null Het
Oas1a C T 5: 121,043,787 (GRCm39) R115H probably benign Het
Or10ag60 C A 2: 87,438,487 (GRCm39) L252I probably benign Het
Or51b6 A G 7: 103,555,879 (GRCm39) T78A probably damaging Het
Or5w19 A G 2: 87,698,574 (GRCm39) M80V probably benign Het
Or8k30 T A 2: 86,339,469 (GRCm39) L222H probably damaging Het
Pbld2 A G 10: 62,883,778 (GRCm39) H142R probably damaging Het
Pcdha4 C T 18: 37,087,869 (GRCm39) T684M probably benign Het
Phc3 G T 3: 31,005,068 (GRCm39) T175N probably damaging Het
Pigs G T 11: 78,219,828 (GRCm39) V68L probably damaging Het
Pik3c2g T A 6: 139,913,528 (GRCm39) D857E possibly damaging Het
Pitpnm3 G A 11: 71,953,998 (GRCm39) P550S probably damaging Het
Pla2g15 G A 8: 106,889,850 (GRCm39) W374* probably null Het
Ptpn14 G A 1: 189,554,839 (GRCm39) C133Y probably damaging Het
Ptpn20 A G 14: 33,336,446 (GRCm39) N95S probably benign Het
Ptrh2 G T 11: 86,580,862 (GRCm39) V160F probably damaging Het
Rapgef3 T C 15: 97,655,256 (GRCm39) D486G probably damaging Het
Rev3l T G 10: 39,699,981 (GRCm39) S1493A probably benign Het
Rgs9 T A 11: 109,116,570 (GRCm39) D411V probably benign Het
Rgsl1 A T 1: 153,669,514 (GRCm39) Y291N probably damaging Het
Rprd2 A G 3: 95,671,849 (GRCm39) Y1185H probably damaging Het
Rpusd3 A G 6: 113,393,167 (GRCm39) probably benign Het
Scnn1a T C 6: 125,299,136 (GRCm39) I72T probably damaging Het
Sdk1 A T 5: 141,842,758 (GRCm39) probably benign Het
Sfmbt2 T C 2: 10,450,556 (GRCm39) L277P probably benign Het
Sgf29 A G 7: 126,264,154 (GRCm39) E73G probably damaging Het
Slc12a6 T A 2: 112,183,306 (GRCm39) F764L probably damaging Het
Slc4a2 T C 5: 24,640,340 (GRCm39) probably null Het
Slc9a3 T G 13: 74,305,838 (GRCm39) V285G probably damaging Het
Slc9c1 A G 16: 45,395,772 (GRCm39) T608A probably benign Het
Slfnl1 C T 4: 120,392,882 (GRCm39) R325C probably damaging Het
Smarcad1 T A 6: 65,051,898 (GRCm39) F344I probably benign Het
Snrnp70 A T 7: 45,026,705 (GRCm39) probably null Het
Spag5 T A 11: 78,205,199 (GRCm39) S633T probably damaging Het
Spta1 A T 1: 174,018,622 (GRCm39) I531L probably benign Het
Stra8 A G 6: 34,910,091 (GRCm39) E60G probably benign Het
Sult2a3 T A 7: 13,845,482 (GRCm39) I126F probably benign Het
Syt1 T C 10: 108,340,373 (GRCm39) H315R possibly damaging Het
Tanc2 T C 11: 105,758,588 (GRCm39) L783P probably damaging Het
Thbs2 C T 17: 14,899,162 (GRCm39) C646Y probably damaging Het
Ticam2 T A 18: 46,693,989 (GRCm39) K33* probably null Het
Trim17 T C 11: 58,845,127 (GRCm39) probably benign Het
Tsr1 G A 11: 74,798,705 (GRCm39) M691I probably benign Het
Ttn T A 2: 76,592,763 (GRCm39) I20790F probably damaging Het
Tubb2b A T 13: 34,312,168 (GRCm39) Y208* probably null Het
Ubr1 T A 2: 120,745,419 (GRCm39) I890F probably damaging Het
Usp54 T C 14: 20,612,260 (GRCm39) E852G probably damaging Het
Vmn2r78 T C 7: 86,603,835 (GRCm39) V671A probably damaging Het
Wipi1 T C 11: 109,470,475 (GRCm39) K315E probably benign Het
Xrn2 T C 2: 146,893,638 (GRCm39) V735A possibly damaging Het
Zdbf2 T A 1: 63,347,973 (GRCm39) D2117E possibly damaging Het
Zfp287 A T 11: 62,604,962 (GRCm39) C648* probably null Het
Zfp369 A G 13: 65,444,614 (GRCm39) T586A possibly damaging Het
Other mutations in Sod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Sod2 APN 17 13,232,464 (GRCm39) missense possibly damaging 0.83
IGL03170:Sod2 APN 17 13,227,257 (GRCm39) missense probably benign
R0735:Sod2 UTSW 17 13,229,451 (GRCm39) missense probably damaging 1.00
R1775:Sod2 UTSW 17 13,233,919 (GRCm39) missense probably damaging 0.96
R1909:Sod2 UTSW 17 13,234,056 (GRCm39) makesense probably null
R6083:Sod2 UTSW 17 13,226,918 (GRCm39) start gained probably benign
R6548:Sod2 UTSW 17 13,227,250 (GRCm39) missense probably benign 0.01
R6670:Sod2 UTSW 17 13,227,252 (GRCm39) missense possibly damaging 0.95
R7526:Sod2 UTSW 17 13,226,918 (GRCm39) start gained probably benign
R8816:Sod2 UTSW 17 13,227,253 (GRCm39) missense probably benign 0.08
R8929:Sod2 UTSW 17 13,233,974 (GRCm39) missense probably damaging 1.00
R8931:Sod2 UTSW 17 13,227,193 (GRCm39) missense probably damaging 1.00
R9767:Sod2 UTSW 17 13,227,180 (GRCm39) missense probably benign 0.03
Z1088:Sod2 UTSW 17 13,232,425 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAGCGGTCGTGTAAAC -3'
(R):5'- AACCAACGGAGGTATTCCCC -3'

Sequencing Primer
(F):5'- GCGGTCGTGTAAACCTCAATAATG -3'
(R):5'- GGTATTCCCCGGCATCGAAAC -3'
Posted On 2016-11-11