Incidental Mutation 'R4951:Ror2'
ID444540
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 042548-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4951 (G1)
Quality Score80
Status Validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53117147 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 391 (V391I)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect probably benign
Transcript: ENSMUST00000021918
AA Change: V391I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: V391I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
AA Change: V379I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: V379I

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Msh5 G A 17: 35,038,420 Q333* probably null Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Pkhd1l1 T A 15: 44,533,891 N2057K possibly damaging Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rif1 T A 2: 52,084,986 probably null Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Serpine1 C T 5: 137,069,351 R156K probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTCAGACTTTTCTTAGC -3'
(R):5'- ATGGCCAGTACCACCAAGTC -3'

Sequencing Primer
(F):5'- GCTTAAAACATCCCATGATAATCTGC -3'
(R):5'- AAGTCAGGCCACCAGTGTCAG -3'
Posted On2016-11-14