Mutagenetix > Incidental Mutations

Incidental Mutation 'R4951:Ror2'

444540

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

042548-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4951 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 53117147 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 391 (V391I)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: V391I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: V391I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: V379I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: V379I

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Meta Mutation Damage Score

0.0681

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	G	9: 35,839,436	V30A	probably damaging	Het
Adcy1	G	A	11: 7,138,336	E452K	possibly damaging	Het
Adcy10	T	C	1: 165,563,963	L1263P	probably damaging	Het
Adgrg1	G	A	8: 95,005,246	V179M	probably damaging	Het
Agap1	T	A	1: 89,609,503	V77E	probably damaging	Het
Ahnak	A	T	19: 9,017,835	K5494N	probably damaging	Het
Arhgap19	A	G	19: 41,774,106	M437T	probably benign	Het
C2cd4c	C	A	10: 79,613,005	A103S	possibly damaging	Het
Clip1	A	T	5: 123,630,345	D776E	probably benign	Het
Cntn3	C	T	6: 102,169,025	V952M	possibly damaging	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Crtac1	C	T	19: 42,414,131	A13T	probably benign	Het
Ddx50	C	T	10: 62,634,120	A363T	probably damaging	Het
Dock9	A	G	14: 121,653,135	V241A	probably benign	Het
Dysf	T	C	6: 84,114,120		probably null	Het
Enpp3	A	T	10: 24,798,277	M375K	probably damaging	Het
Fam13c	G	A	10: 70,551,791		probably null	Het
Ftcd	C	T	10: 76,584,683	A417V	probably benign	Het
Gak	A	G	5: 108,582,718	S941P	probably benign	Het
Ganc	A	G	2: 120,456,047	T786A	probably benign	Het
Gfi1	A	C	5: 107,720,143	S420A	probably damaging	Het
Ghsr	A	T	3: 27,372,361	T189S	possibly damaging	Het
Glb1l	C	T	1: 75,208,375	G122D	probably damaging	Het
Gm10065	C	T	13: 21,479,251	S64N	unknown	Het
Gm5087	C	A	14: 13,158,749		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm973	G	A	1: 59,541,474		probably null	Het
Gm9930	A	T	10: 9,534,705		noncoding transcript	Het
H6pd	A	T	4: 149,981,587	Y781N	probably damaging	Het
Ide	G	A	19: 37,285,232	L695F	unknown	Het
Il17re	T	A	6: 113,468,907	V393E	probably damaging	Het
Lipo1	A	G	19: 33,782,221	V205A	probably benign	Het
Lipo5	C	T	19: 33,468,851	E49K	probably damaging	Het
Lonp1	A	T	17: 56,620,335	M306K	possibly damaging	Het
Lrig1	A	G	6: 94,663,978	L82P	probably damaging	Het
Lrp2	A	T	2: 69,535,988	C256S	probably damaging	Het
Map1b	A	T	13: 99,432,427	I1262K	unknown	Het
Mctp1	C	T	13: 76,827,775	P756S	probably damaging	Het
Mdn1	T	A	4: 32,707,459	W1583R	probably damaging	Het
Mis12	T	A	11: 71,025,647	Y169N	probably benign	Het
Msh5	G	A	17: 35,038,420	Q333*	probably null	Het
Necap2	A	T	4: 141,072,523		probably null	Het
Nfatc2	T	C	2: 168,571,072	D211G	probably damaging	Het
Nlrx1	A	G	9: 44,253,429	V906A	possibly damaging	Het
Olfr1239	T	A	2: 89,417,772	I214F	probably benign	Het
Olfr1456-ps1	A	T	19: 13,079,256		noncoding transcript	Het
Olfr320	G	A	11: 58,684,763	V297I	probably damaging	Het
Olfr723	A	T	14: 49,929,058	L162*	probably null	Het
Olfr938	A	G	9: 39,078,259	F162S	probably benign	Het
Pkhd1l1	T	A	15: 44,533,891	N2057K	possibly damaging	Het
Ppip5k2	T	C	1: 97,711,749	K1078R	possibly damaging	Het
Prdm11	A	G	2: 92,980,609	I215T	probably damaging	Het
Ptpn13	C	T	5: 103,588,046	P2137L	probably benign	Het
Rif1	T	A	2: 52,084,986		probably null	Het
Rnf17	T	C	14: 56,522,391	V1551A	probably benign	Het
Rps6ka2	A	T	17: 7,292,789	D542V	probably damaging	Het
Sema4g	A	G	19: 44,996,571		probably null	Het
Serpinb6d	T	G	13: 33,666,383	S64R	probably benign	Het
Serpine1	C	T	5: 137,069,351	R156K	probably benign	Het
Setdb2	A	G	14: 59,402,303	I713T	possibly damaging	Het
Slamf7	A	G	1: 171,639,125	F171L	probably benign	Het
Slc15a5	A	G	6: 138,073,066	L117S	probably damaging	Het
Slc8a3	T	A	12: 81,314,699	T449S	probably benign	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Smc2	G	A	4: 52,462,926	V639M	possibly damaging	Het
Sra1	A	T	18: 36,676,441	C223*	probably null	Het
Srgap1	A	T	10: 121,785,552	M1012K	probably benign	Het
Stk-ps2	A	T	1: 46,029,442		noncoding transcript	Het
Taar6	A	T	10: 23,985,208	S147T	probably benign	Het
Taf15	G	A	11: 83,484,811	G34D	possibly damaging	Het
Tarbp1	T	C	8: 126,447,445	E874G	possibly damaging	Het
Tob2	T	C	15: 81,851,723	Y15C	probably damaging	Het
Trim12a	A	G	7: 104,304,358	V182A	possibly damaging	Het
Trim67	A	G	8: 124,794,667	E256G	probably benign	Het
Trrap	T	A	5: 144,805,720	S1382T	possibly damaging	Het
Ttc39d	T	A	17: 80,216,033	S40R	probably benign	Het
Ttn	A	T	2: 76,949,062	V1158E	probably benign	Het
Vmn1r19	C	T	6: 57,404,942	T160I	probably benign	Het
Vmn2r100	T	C	17: 19,532,038	I781T	probably benign	Het
Vmn2r85	T	C	10: 130,425,244	E408G	probably damaging	Het
Vwde	T	C	6: 13,187,139	D783G	probably damaging	Het
Wdr27	A	T	17: 14,876,133	D796E	probably damaging	Het
Zfp365	C	T	10: 67,889,991		probably null	Het
Zfp9	T	G	6: 118,464,447	H418P	probably damaging	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAGTCAGACTTTTCTTAGC -3'
(R):5'- ATGGCCAGTACCACCAAGTC -3'

Sequencing Primer
(F):5'- GCTTAAAACATCCCATGATAATCTGC -3'
(R):5'- AAGTCAGGCCACCAGTGTCAG -3'

Posted On

2016-11-14