Incidental Mutation 'R4951:Pkhd1l1'
ID444541
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Namepolycystic kidney and hepatic disease 1-like 1
SynonymsPKHDL1, D86 mRNA, fibrocystin L
MMRRC Submission 042548-MU
Accession Numbers

Genbank: NM_138674; MGI: 2183153

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4951 (G1)
Quality Score211
Status Validated
Chromosome15
Chromosomal Location44457494-44601369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44533891 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2057 (N2057K)
Ref Sequence ENSEMBL: ENSMUSP00000147447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038336
AA Change: N2057K

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: N2057K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166957
AA Change: N2057K

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: N2057K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209244
AA Change: N2057K

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231867
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Msh5 G A 17: 35,038,420 Q333* probably null Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rif1 T A 2: 52,084,986 probably null Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Ror2 C T 13: 53,117,147 V391I probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Serpine1 C T 5: 137,069,351 R156K probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44477586 missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44556019 missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44491029 missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44591992 missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44500047 missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44586474 missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44562752 splice site probably null
IGL01089:Pkhd1l1 APN 15 44483869 splice site probably benign
IGL01094:Pkhd1l1 APN 15 44546929 missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44505312 critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44530029 missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44532982 missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44483833 nonsense probably null
IGL01546:Pkhd1l1 APN 15 44566316 missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44529410 missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44529351 missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44499400 splice site probably benign
IGL02007:Pkhd1l1 APN 15 44533733 splice site probably benign
IGL02041:Pkhd1l1 APN 15 44493056 splice site probably null
IGL02171:Pkhd1l1 APN 15 44516146 missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44512849 missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44573614 missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44459426 missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44558597 missense probably benign
IGL02522:Pkhd1l1 APN 15 44555902 missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44578500 missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44526054 splice site probably null
IGL02602:Pkhd1l1 APN 15 44557931 missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44589456 missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44584873 missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44539667 missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44564324 missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44483814 missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44530045 critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44516209 critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44540950 missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44501493 missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44529543 missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44501531 missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44512908 missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44558004 missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44591976 missense probably benign 0.00
IGL03030:Pkhd1l1 APN 15 44596902 missense probably benign 0.41
IGL03132:Pkhd1l1 APN 15 44574617 missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44518135 missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44596895 missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44581826 missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44538952 missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44594584 missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44547518 splice site probably benign
IGL03377:Pkhd1l1 APN 15 44484351 splice site probably null
K7371:Pkhd1l1 UTSW 15 44537442 missense possibly damaging 0.67
K7371:Pkhd1l1 UTSW 15 44500067 missense possibly damaging 0.94
N/A - 287:Pkhd1l1 UTSW 15 44582258 missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44523499 missense probably benign 0.17
P4717OSA:Pkhd1l1 UTSW 15 44528247 missense probably damaging 1.00
R0007:Pkhd1l1 UTSW 15 44574398 splice site probably benign
R0020:Pkhd1l1 UTSW 15 44556872 missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44504009 missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44573625 missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44556008 missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0127:Pkhd1l1 UTSW 15 44554605 missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44526784 missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44560435 missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44522738 splice site probably benign
R0344:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44501519 missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44519690 missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44589418 missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44526754 missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44523491 critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44489546 missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44484424 missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44467424 missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44483838 missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44535788 missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44529264 missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44495597 missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44538883 splice site probably null
R0942:Pkhd1l1 UTSW 15 44532959 missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44591964 missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44498051 missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44497996 missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44589597 missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44540988 splice site probably benign
R1445:Pkhd1l1 UTSW 15 44505644 missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44516115 missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44545494 missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44545501 splice site probably null
R1571:Pkhd1l1 UTSW 15 44526841 missense probably benign
R1572:Pkhd1l1 UTSW 15 44543473 missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44467367 nonsense probably null
R1638:Pkhd1l1 UTSW 15 44597117 missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44540955 missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44547509 critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44528239 missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44503345 missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44525242 missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44503337 missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44540884 missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44500038 missense probably benign
R1975:Pkhd1l1 UTSW 15 44529713 missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44499982 intron probably null
R2037:Pkhd1l1 UTSW 15 44568221 splice site probably null
R2045:Pkhd1l1 UTSW 15 44479654 missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44547513 splice site probably benign
R2049:Pkhd1l1 UTSW 15 44581741 missense probably damaging 1.00
R2063:Pkhd1l1 UTSW 15 44550752 missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44527767 missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44569482 missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44516185 missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44501457 missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44529818 missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44512877 synonymous probably null
R2150:Pkhd1l1 UTSW 15 44499982 intron probably null
R2177:Pkhd1l1 UTSW 15 44459395 missense probably benign
R2184:Pkhd1l1 UTSW 15 44499296 missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44573895 missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44546927 missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44528250 missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44479607 missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44560506 missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44533019 missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44528178 missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44550820 missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44485428 missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44545386 missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44547248 missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44545370 missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44547364 missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44526869 missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44546587 missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44589406 missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44514975 critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44493135 missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44592026 critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44529100 missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44498557 missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44550760 missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44523649 missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44591906 missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44505553 missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44581804 missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44550885 missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44539682 missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44484400 missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44547347 missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44556032 missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44498021 missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44529405 missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44491101 missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4963:Pkhd1l1 UTSW 15 44504025 missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44582227 missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44568324 missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44457616 missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44582293 missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44591887 missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44547148 missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44547041 missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44495647 nonsense probably null
R5286:Pkhd1l1 UTSW 15 44514972 nonsense probably null
R5292:Pkhd1l1 UTSW 15 44529566 missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44535750 missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44504046 missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44546862 missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44540967 missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44558646 missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44532992 missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44545417 missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44519707 missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44566322 missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44581790 missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44578588 missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44526763 missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44532965 missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44459463 missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44545416 missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44525988 missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44489504 splice site probably null
R6066:Pkhd1l1 UTSW 15 44528129 missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44529559 missense probably benign
R6294:Pkhd1l1 UTSW 15 44570028 missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44589525 missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44498089 critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44529143 missense probably benign
R6736:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44589663 missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44562655 missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44589527 missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44522629 missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44511674 missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44566268 missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44573631 missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44557976 missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44584978 critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44573637 missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44467404 missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44529116 missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44523553 missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44528163 missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44522695 missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44546941 missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44503280 missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44498590 missense probably benign
R7304:Pkhd1l1 UTSW 15 44498482 missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44514954 missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44589486 missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44595011 missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44505185 nonsense probably null
R7481:Pkhd1l1 UTSW 15 44512911 missense probably benign
R7554:Pkhd1l1 UTSW 15 44495470 missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44550761 missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44514930 missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44568364 critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44495521 missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44527737 missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44586408 missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44529884 missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44540907 missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44543569 missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44578581 missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44597138 nonsense probably null
RF006:Pkhd1l1 UTSW 15 44503238 missense probably benign 0.03
RF006:Pkhd1l1 UTSW 15 44558507 critical splice acceptor site probably benign
RF008:Pkhd1l1 UTSW 15 44558505 critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44558505 critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44558507 critical splice acceptor site probably benign
RF030:Pkhd1l1 UTSW 15 44558502 critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44558506 critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44558503 critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44558495 critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44591966 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACATTTCCTGCACATTTGTTCATG -3'
(R):5'- CAGGTTTTCCATTTGAATGCTCAAC -3'

Sequencing Primer
(F):5'- GCACATTTGTTCATGTTCTCCTTG -3'
(R):5'- GATGGTCATACATCCAACTCA -3'
Posted On2016-11-14