Incidental Mutation 'R4963:Spata18'
ID444543
Institutional Source Beutler Lab
Gene Symbol Spata18
Ensembl Gene ENSMUSG00000029155
Gene Namespermatogenesis associated 18
Synonyms
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73651379-73679512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73678993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 419 (V419E)
Ref Sequence ENSEMBL: ENSMUSP00000137444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]
Predicted Effect probably benign
Transcript: ENSMUST00000041422
SMART Domains Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
coiled coil region 178 211 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071077
AA Change: V521E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: V521E

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113548
SMART Domains Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
Pfam:MIEAP 6 195 2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178631
AA Change: V419E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155
AA Change: V419E

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Pfam:MIEAP 296 485 1.2e-65 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Ldb3 T G 14: 34,566,858 S252R probably damaging Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Spata18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Spata18 APN 5 73657754 missense possibly damaging 0.80
IGL01331:Spata18 APN 5 73669681 missense probably damaging 1.00
IGL01394:Spata18 APN 5 73679345 splice site probably null
IGL01994:Spata18 APN 5 73657601 critical splice donor site probably null
IGL02192:Spata18 APN 5 73672518 splice site probably null
IGL02253:Spata18 APN 5 73668596 missense possibly damaging 0.61
IGL03195:Spata18 APN 5 73671248 missense probably damaging 1.00
IGL03204:Spata18 APN 5 73671106 splice site probably benign
ANU74:Spata18 UTSW 5 73671113 missense probably damaging 1.00
R0312:Spata18 UTSW 5 73666881 missense probably benign 0.00
R0557:Spata18 UTSW 5 73651670 missense probably damaging 1.00
R1624:Spata18 UTSW 5 73669545 missense probably damaging 0.98
R1901:Spata18 UTSW 5 73671139 missense probably damaging 1.00
R1937:Spata18 UTSW 5 73676964 missense probably damaging 1.00
R2228:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2229:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2896:Spata18 UTSW 5 73657802 missense probably damaging 1.00
R3082:Spata18 UTSW 5 73679080 intron probably benign
R3716:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R3717:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R4061:Spata18 UTSW 5 73671166 missense probably damaging 1.00
R4299:Spata18 UTSW 5 73666902 missense probably benign 0.36
R5603:Spata18 UTSW 5 73671232 missense probably benign 0.12
R6381:Spata18 UTSW 5 73675216 missense probably damaging 1.00
R6581:Spata18 UTSW 5 73669516 missense probably benign 0.14
R7062:Spata18 UTSW 5 73659293 missense probably benign 0.08
R7591:Spata18 UTSW 5 73672416 missense
R7682:Spata18 UTSW 5 73668665 missense
R7688:Spata18 UTSW 5 73651662 missense probably benign 0.14
R7783:Spata18 UTSW 5 73668610 missense
R8051:Spata18 UTSW 5 73669720 missense
X0061:Spata18 UTSW 5 73666859 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTCTTTAGCCATTGAACCCAAC -3'
(R):5'- TTCTGTACCTCATGACACCAGAC -3'

Sequencing Primer
(F):5'- TTTAGCCATTGAACCCAACTTTCAAC -3'
(R):5'- ACAATCAATGAGAGTGCCCAG -3'
Posted On2016-11-14