Incidental Mutation 'R4963:Timd2'
ID 444544
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene Name T cell immunoglobulin and mucin domain containing 2
Synonyms TIM-2, Tim2
MMRRC Submission 042560-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R4963 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 46559787-46597888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46573617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 129 (E129G)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000125008] [ENSMUST00000169584]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000055102
AA Change: E129G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: E129G

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109225
AA Change: E129G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: E129G

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125008
SMART Domains Protein: ENSMUSP00000123042
Gene: ENSMUSG00000040413

DomainStartEndE-ValueType
PDB:2OR7|B 19 92 6e-50 PDB
Blast:IG 22 92 4e-47 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169584
AA Change: E129G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: E129G

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,470,582 (GRCm39) I133N probably benign Het
Abca15 T C 7: 119,960,142 (GRCm39) S642P probably damaging Het
Abcg5 G T 17: 84,967,569 (GRCm39) Y410* probably null Het
Anapc7 T A 5: 122,560,669 (GRCm39) M10K probably damaging Het
Ank2 G A 3: 126,825,745 (GRCm39) T418M probably benign Het
Arhgap17 T C 7: 122,907,583 (GRCm39) R260G possibly damaging Het
Atp1a3 T C 7: 24,694,051 (GRCm39) T381A probably damaging Het
Cep89 T G 7: 35,102,577 (GRCm39) S97A probably benign Het
Cyp2j11 T C 4: 96,204,619 (GRCm39) D309G probably damaging Het
Dcbld2 T C 16: 58,286,145 (GRCm39) I768T probably benign Het
Defa41 C T 8: 21,691,774 (GRCm39) S52F probably damaging Het
Dgke A G 11: 88,941,628 (GRCm39) V249A possibly damaging Het
Dnah9 T C 11: 65,975,437 (GRCm39) probably null Het
Dnajc3 C A 14: 119,215,585 (GRCm39) H502N probably benign Het
Dsp A G 13: 38,381,846 (GRCm39) T2265A probably damaging Het
Enpp6 A G 8: 47,518,496 (GRCm39) D208G probably benign Het
Evc C T 5: 37,479,393 (GRCm39) probably null Het
Fam98a A G 17: 75,845,977 (GRCm39) S285P probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gsdmc A G 15: 63,676,229 (GRCm39) probably null Het
Gtpbp4 C A 13: 9,035,253 (GRCm39) D369Y probably damaging Het
H2-M1 A G 17: 36,982,630 (GRCm39) Y77H probably benign Het
Irx2 T C 13: 72,780,729 (GRCm39) V466A possibly damaging Het
Kcnh4 C A 11: 100,643,079 (GRCm39) W396L probably damaging Het
Kif27 T C 13: 58,476,808 (GRCm39) D614G possibly damaging Het
Kirrel2 C A 7: 30,150,226 (GRCm39) probably null Het
Lcn5 A G 2: 25,551,426 (GRCm39) I182V probably benign Het
Ldb3 T G 14: 34,288,815 (GRCm39) S252R probably damaging Het
Marchf8 G A 6: 116,363,232 (GRCm39) probably benign Het
Mdn1 C A 4: 32,756,512 (GRCm39) Q4735K probably benign Het
Mfrp A T 9: 44,014,561 (GRCm39) H236L probably benign Het
Mlph A G 1: 90,867,112 (GRCm39) D378G probably damaging Het
Msi1 T A 5: 115,588,944 (GRCm39) Y320N probably damaging Het
Mtmr11 T C 3: 96,070,567 (GRCm39) probably benign Het
Mtpap T C 18: 4,375,638 (GRCm39) V6A probably benign Het
Nedd1 C A 10: 92,530,893 (GRCm39) D399Y probably damaging Het
Ninl A G 2: 150,781,829 (GRCm39) Y234H probably benign Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nle1 A G 11: 82,795,763 (GRCm39) V228A probably benign Het
Npy4r T A 14: 33,868,973 (GRCm39) D105V probably damaging Het
Or1f12 A G 13: 21,722,152 (GRCm39) Y8H probably damaging Het
Palld C T 8: 62,156,244 (GRCm39) V464M probably damaging Het
Pclo T C 5: 14,719,235 (GRCm39) V1124A unknown Het
Pex1 T A 5: 3,659,924 (GRCm39) M476K probably benign Het
Pkhd1l1 G A 15: 44,367,421 (GRCm39) S773N probably benign Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Prmt9 A G 8: 78,282,358 (GRCm39) D85G probably damaging Het
Ptpn12 T A 5: 21,220,706 (GRCm39) probably null Het
Rbm19 T A 5: 120,279,631 (GRCm39) M766K probably damaging Het
Rdh11 A G 12: 79,235,380 (GRCm39) V72A probably benign Het
Rxfp3 A G 15: 11,036,367 (GRCm39) V335A probably damaging Het
Sema6a T C 18: 47,431,318 (GRCm39) K127E possibly damaging Het
Slc5a1 C T 5: 33,318,126 (GRCm39) T593I probably benign Het
Slco1a1 A G 6: 141,868,825 (GRCm39) F380L probably benign Het
Smc2 T C 4: 52,450,826 (GRCm39) S215P probably damaging Het
Smyd2 A T 1: 189,614,385 (GRCm39) V381E probably damaging Het
Smyd4 C T 11: 75,273,120 (GRCm39) S60L probably benign Het
Spata18 T A 5: 73,836,336 (GRCm39) V419E probably damaging Het
Terb1 A G 8: 105,208,950 (GRCm39) L376S probably damaging Het
Topbp1 C A 9: 103,197,804 (GRCm39) T461K probably benign Het
Tpp2 G A 1: 44,031,428 (GRCm39) R1069Q probably damaging Het
Ttn A G 2: 76,584,289 (GRCm39) V22273A probably damaging Het
Tulp4 G A 17: 6,249,088 (GRCm39) E36K probably damaging Het
Uqcrfs1 A T 13: 30,724,746 (GRCm39) F265I probably damaging Het
Vmn2r107 A T 17: 20,595,403 (GRCm39) Q652L probably damaging Het
Vwf C T 6: 125,644,446 (GRCm39) R2434* probably null Het
Wdhd1 A G 14: 47,506,146 (GRCm39) V256A possibly damaging Het
Zfp442 A T 2: 150,250,415 (GRCm39) C439S probably damaging Het
Zfp709 A G 8: 72,643,632 (GRCm39) T354A probably benign Het
Zswim2 A T 2: 83,755,454 (GRCm39) I149N probably damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46,567,170 (GRCm39) missense probably benign 0.15
IGL01289:Timd2 APN 11 46,570,499 (GRCm39) missense probably benign 0.00
IGL02066:Timd2 APN 11 46,569,050 (GRCm39) missense probably damaging 0.98
IGL02439:Timd2 APN 11 46,569,063 (GRCm39) splice site probably benign
R2217:Timd2 UTSW 11 46,577,844 (GRCm39) missense probably damaging 1.00
R2218:Timd2 UTSW 11 46,577,844 (GRCm39) missense probably damaging 1.00
R2240:Timd2 UTSW 11 46,569,043 (GRCm39) missense probably benign 0.01
R3621:Timd2 UTSW 11 46,569,040 (GRCm39) missense probably benign 0.00
R3876:Timd2 UTSW 11 46,561,847 (GRCm39) critical splice acceptor site probably null
R4173:Timd2 UTSW 11 46,561,787 (GRCm39) missense probably benign 0.00
R4793:Timd2 UTSW 11 46,578,008 (GRCm39) missense probably damaging 1.00
R4799:Timd2 UTSW 11 46,568,094 (GRCm39) nonsense probably null
R5314:Timd2 UTSW 11 46,568,087 (GRCm39) missense probably benign 0.09
R5798:Timd2 UTSW 11 46,568,064 (GRCm39) missense probably benign 0.06
R6074:Timd2 UTSW 11 46,577,999 (GRCm39) missense possibly damaging 0.88
R6090:Timd2 UTSW 11 46,578,063 (GRCm39) missense probably benign 0.11
R6694:Timd2 UTSW 11 46,561,779 (GRCm39) nonsense probably null
R7817:Timd2 UTSW 11 46,561,781 (GRCm39) missense probably benign 0.00
R8379:Timd2 UTSW 11 46,568,027 (GRCm39) splice site probably null
R9321:Timd2 UTSW 11 46,577,916 (GRCm39) missense probably benign 0.00
R9483:Timd2 UTSW 11 46,577,889 (GRCm39) missense probably damaging 1.00
R9763:Timd2 UTSW 11 46,573,540 (GRCm39) missense probably benign 0.01
Z1177:Timd2 UTSW 11 46,570,506 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACTCAGTATCTGTGTGTCCTACTG -3'
(R):5'- CATCCATGCTGTCAGTGCAG -3'

Sequencing Primer
(F):5'- CTTCATAAGAAGGACTCTGGGCC -3'
(R):5'- AGTGCAGCTGCCTCCTATG -3'
Posted On 2016-11-14