Incidental Mutation 'R4963:Ldb3'
ID444545
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene NameLIM domain binding 3
Synonymscypher, ZASP
MMRRC Submission 042560-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4963 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34526603-34588682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34566858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 252 (S252R)
Ref Sequence ENSEMBL: ENSMUSP00000066784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000022330] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000227819] [ENSMUST00000228044]
Predicted Effect probably benign
Transcript: ENSMUST00000022327
AA Change: S296R

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798
AA Change: S296R

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000022328
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000022330
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064098
AA Change: S252R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798
AA Change: S252R

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090040
AA Change: S257R

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798
AA Change: S257R

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000227819
Predicted Effect silent
Transcript: ENSMUST00000228044
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,163,414 I133N probably benign Het
Abca15 T C 7: 120,360,919 S642P probably damaging Het
Abcg5 G T 17: 84,660,141 Y410* probably null Het
Anapc7 T A 5: 122,422,606 M10K probably damaging Het
Ank2 G A 3: 127,032,096 T418M probably benign Het
Arhgap17 T C 7: 123,308,360 R260G possibly damaging Het
Atp1a3 T C 7: 24,994,626 T381A probably damaging Het
Cep89 T G 7: 35,403,152 S97A probably benign Het
Cyp2j11 T C 4: 96,316,382 D309G probably damaging Het
Dcbld2 T C 16: 58,465,782 I768T probably benign Het
Dgke A G 11: 89,050,802 V249A possibly damaging Het
Dnah9 T C 11: 66,084,611 probably null Het
Dnajc3 C A 14: 118,978,173 H502N probably benign Het
Dsp A G 13: 38,197,870 T2265A probably damaging Het
Enpp6 A G 8: 47,065,461 D208G probably benign Het
Evc C T 5: 37,322,049 probably null Het
Fam98a A G 17: 75,538,982 S285P probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm15293 C T 8: 21,201,758 S52F probably damaging Het
Gsdmc A G 15: 63,804,380 probably null Het
Gtpbp4 C A 13: 8,985,217 D369Y probably damaging Het
H2-M1 A G 17: 36,671,738 Y77H probably benign Het
Irx2 T C 13: 72,632,610 V466A possibly damaging Het
Kcnh4 C A 11: 100,752,253 W396L probably damaging Het
Kif27 T C 13: 58,328,994 D614G possibly damaging Het
Kirrel2 C A 7: 30,450,801 probably null Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
March8 G A 6: 116,386,271 probably benign Het
Mdn1 C A 4: 32,756,512 Q4735K probably benign Het
Mfrp A T 9: 44,103,264 H236L probably benign Het
Mlph A G 1: 90,939,390 D378G probably damaging Het
Msi1 T A 5: 115,450,885 Y320N probably damaging Het
Mtmr11 T C 3: 96,163,250 probably benign Het
Mtpap T C 18: 4,375,638 V6A probably benign Het
Nedd1 C A 10: 92,695,031 D399Y probably damaging Het
Ninl A G 2: 150,939,909 Y234H probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nle1 A G 11: 82,904,937 V228A probably benign Het
Npy4r T A 14: 34,147,016 D105V probably damaging Het
Olfr1366 A G 13: 21,537,982 Y8H probably damaging Het
Palld C T 8: 61,703,210 V464M probably damaging Het
Pclo T C 5: 14,669,221 V1124A unknown Het
Pex1 T A 5: 3,609,924 M476K probably benign Het
Pkhd1l1 G A 15: 44,504,025 S773N probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prmt9 A G 8: 77,555,729 D85G probably damaging Het
Ptpn12 T A 5: 21,015,708 probably null Het
Rbm19 T A 5: 120,141,566 M766K probably damaging Het
Rdh11 A G 12: 79,188,606 V72A probably benign Het
Rxfp3 A G 15: 11,036,281 V335A probably damaging Het
Sema6a T C 18: 47,298,251 K127E possibly damaging Het
Slc5a1 C T 5: 33,160,782 T593I probably benign Het
Slco1a1 A G 6: 141,923,099 F380L probably benign Het
Smc2 T C 4: 52,450,826 S215P probably damaging Het
Smyd2 A T 1: 189,882,188 V381E probably damaging Het
Smyd4 C T 11: 75,382,294 S60L probably benign Het
Spata18 T A 5: 73,678,993 V419E probably damaging Het
Terb1 A G 8: 104,482,318 L376S probably damaging Het
Timd2 T C 11: 46,682,790 E129G possibly damaging Het
Topbp1 C A 9: 103,320,605 T461K probably benign Het
Tpp2 G A 1: 43,992,268 R1069Q probably damaging Het
Ttn A G 2: 76,753,945 V22273A probably damaging Het
Tulp4 G A 17: 6,198,813 E36K probably damaging Het
Uqcrfs1 A T 13: 30,540,763 F265I probably damaging Het
Vmn2r107 A T 17: 20,375,141 Q652L probably damaging Het
Vwf C T 6: 125,667,483 R2434* probably null Het
Wdhd1 A G 14: 47,268,689 V256A possibly damaging Het
Zfp442 A T 2: 150,408,495 C439S probably damaging Het
Zfp709 A G 8: 71,889,788 T354A probably benign Het
Zswim2 A T 2: 83,925,110 I149N probably damaging Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R2865:Ldb3 UTSW 14 34529503 missense probably damaging 1.00
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3765:Ldb3 UTSW 14 34578682 splice site probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6549:Ldb3 UTSW 14 34541897 missense probably damaging 0.99
R6682:Ldb3 UTSW 14 34552264 missense possibly damaging 0.77
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7132:Ldb3 UTSW 14 34577035 missense probably benign 0.25
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
R7488:Ldb3 UTSW 14 34567445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCTCCAAAGCCCAGTGAAGG -3'
(R):5'- CACAGGAAGTGTTTAGGGCC -3'

Sequencing Primer
(F):5'- CTCTACCTTGGTGACCTGGGAAAG -3'
(R):5'- TATGTTCGCTGTGAGTCC -3'
Posted On2016-11-14