Incidental Mutation 'R4972:Thsd7b'
ID 444546
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Name thrombospondin, type I, domain containing 7B
Synonyms 1700074E13Rik, D130067I03Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R4972 (G1)
Quality Score 48
Status Validated
Chromosome 1
Chromosomal Location 129201039-130147015 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130116309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 1354 (P1354H)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
AlphaFold Q6P4U0
Predicted Effect probably damaging
Transcript: ENSMUST00000073527
AA Change: P1354H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: P1354H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Meta Mutation Damage Score 0.3576 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129,523,571 (GRCm39) missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130,092,814 (GRCm39) missense probably benign 0.00
IGL00987:Thsd7b APN 1 129,541,016 (GRCm39) missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129,523,883 (GRCm39) missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129,704,071 (GRCm39) missense probably benign 0.29
IGL01535:Thsd7b APN 1 129,605,954 (GRCm39) missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130,145,918 (GRCm39) utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129,358,665 (GRCm39) missense probably benign 0.07
IGL01775:Thsd7b APN 1 129,556,676 (GRCm39) missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129,744,419 (GRCm39) missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129,523,508 (GRCm39) missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130,087,369 (GRCm39) missense probably benign 0.01
IGL02404:Thsd7b APN 1 129,540,888 (GRCm39) missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129,540,932 (GRCm39) missense probably benign 0.22
IGL02543:Thsd7b APN 1 130,092,840 (GRCm39) missense probably benign 0.03
IGL02740:Thsd7b APN 1 129,540,864 (GRCm39) missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129,843,352 (GRCm39) missense probably benign 0.01
IGL03108:Thsd7b APN 1 130,138,013 (GRCm39) missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130,116,288 (GRCm39) missense probably benign 0.00
IGL03195:Thsd7b APN 1 129,556,646 (GRCm39) missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129,688,092 (GRCm39) missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129,523,901 (GRCm39) missense probably benign 0.17
IGL03399:Thsd7b APN 1 129,556,622 (GRCm39) missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129,358,701 (GRCm39) missense probably benign 0.00
R0277:Thsd7b UTSW 1 130,123,000 (GRCm39) missense probably benign 0.00
R0526:Thsd7b UTSW 1 129,879,129 (GRCm39) missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130,116,263 (GRCm39) missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130,116,268 (GRCm39) missense probably benign 0.00
R0784:Thsd7b UTSW 1 129,523,096 (GRCm39) splice site probably benign
R1158:Thsd7b UTSW 1 130,117,672 (GRCm39) splice site probably null
R1267:Thsd7b UTSW 1 129,556,577 (GRCm39) splice site probably null
R1375:Thsd7b UTSW 1 130,087,423 (GRCm39) missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129,523,778 (GRCm39) missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1728:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1728:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1728:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1729:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1729:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1730:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1730:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1739:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1739:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1762:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1762:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 130,030,813 (GRCm39) missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1783:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1783:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1784:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1784:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1785:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1785:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1812:Thsd7b UTSW 1 129,686,347 (GRCm39) missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129,540,993 (GRCm39) missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129,605,846 (GRCm39) missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129,686,188 (GRCm39) nonsense probably null
R2199:Thsd7b UTSW 1 130,145,895 (GRCm39) missense probably benign 0.04
R2483:Thsd7b UTSW 1 130,030,809 (GRCm39) missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130,117,587 (GRCm39) splice site probably benign
R2935:Thsd7b UTSW 1 129,605,824 (GRCm39) missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 129,977,599 (GRCm39) missense probably benign 0.23
R3236:Thsd7b UTSW 1 130,145,855 (GRCm39) nonsense probably null
R3745:Thsd7b UTSW 1 129,605,978 (GRCm39) missense probably benign 0.04
R3877:Thsd7b UTSW 1 130,117,919 (GRCm39) missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129,523,107 (GRCm39) missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4112:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4255:Thsd7b UTSW 1 129,688,024 (GRCm39) missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129,358,652 (GRCm39) missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 129,977,646 (GRCm39) intron probably benign
R4732:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130,138,001 (GRCm39) missense probably benign 0.01
R4805:Thsd7b UTSW 1 130,116,276 (GRCm39) missense probably benign 0.04
R4840:Thsd7b UTSW 1 129,523,581 (GRCm39) missense probably benign 0.00
R4879:Thsd7b UTSW 1 130,116,236 (GRCm39) missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129,605,882 (GRCm39) missense probably benign 0.00
R5304:Thsd7b UTSW 1 129,605,980 (GRCm39) nonsense probably null
R5422:Thsd7b UTSW 1 129,849,071 (GRCm39) missense probably benign 0.41
R5495:Thsd7b UTSW 1 129,523,570 (GRCm39) missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129,523,578 (GRCm39) missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130,090,673 (GRCm39) critical splice donor site probably null
R5638:Thsd7b UTSW 1 129,523,270 (GRCm39) missense probably benign 0.00
R5640:Thsd7b UTSW 1 130,044,408 (GRCm39) nonsense probably null
R5655:Thsd7b UTSW 1 129,556,671 (GRCm39) splice site probably null
R5711:Thsd7b UTSW 1 129,688,139 (GRCm39) missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129,605,821 (GRCm39) missense probably benign 0.00
R5888:Thsd7b UTSW 1 130,138,057 (GRCm39) nonsense probably null
R5932:Thsd7b UTSW 1 129,358,575 (GRCm39) missense probably benign
R6243:Thsd7b UTSW 1 130,090,599 (GRCm39) missense probably benign 0.21
R6258:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6260:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6399:Thsd7b UTSW 1 129,744,385 (GRCm39) missense probably benign 0.13
R6437:Thsd7b UTSW 1 129,744,419 (GRCm39) missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130,087,451 (GRCm39) splice site probably null
R6785:Thsd7b UTSW 1 129,358,644 (GRCm39) missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130,030,890 (GRCm39) missense probably benign 0.01
R7334:Thsd7b UTSW 1 130,123,012 (GRCm39) missense probably benign 0.00
R7414:Thsd7b UTSW 1 129,556,717 (GRCm39) missense probably damaging 0.99
R7673:Thsd7b UTSW 1 129,843,487 (GRCm39) splice site probably null
R7683:Thsd7b UTSW 1 129,523,683 (GRCm39) missense probably damaging 0.99
R7861:Thsd7b UTSW 1 130,087,435 (GRCm39) missense probably benign 0.00
R8145:Thsd7b UTSW 1 129,688,036 (GRCm39) missense probably damaging 1.00
R8241:Thsd7b UTSW 1 130,117,688 (GRCm39) missense probably damaging 1.00
R8296:Thsd7b UTSW 1 129,523,193 (GRCm39) missense probably benign 0.01
R8355:Thsd7b UTSW 1 129,523,616 (GRCm39) missense probably damaging 1.00
R8507:Thsd7b UTSW 1 129,605,790 (GRCm39) missense probably benign 0.21
R8520:Thsd7b UTSW 1 129,849,157 (GRCm39) missense probably benign 0.07
R8555:Thsd7b UTSW 1 129,523,191 (GRCm39) missense probably damaging 1.00
R8682:Thsd7b UTSW 1 129,688,011 (GRCm39) nonsense probably null
R8981:Thsd7b UTSW 1 129,523,187 (GRCm39) missense possibly damaging 0.88
R9029:Thsd7b UTSW 1 130,087,426 (GRCm39) missense probably damaging 1.00
R9133:Thsd7b UTSW 1 129,843,382 (GRCm39) missense probably benign 0.18
R9194:Thsd7b UTSW 1 129,843,371 (GRCm39) missense possibly damaging 0.78
R9229:Thsd7b UTSW 1 129,849,027 (GRCm39) missense probably damaging 1.00
R9239:Thsd7b UTSW 1 130,087,453 (GRCm39) critical splice donor site probably null
R9460:Thsd7b UTSW 1 130,090,674 (GRCm39) critical splice donor site probably null
R9466:Thsd7b UTSW 1 130,122,866 (GRCm39) missense probably benign
R9588:Thsd7b UTSW 1 130,108,223 (GRCm39) missense probably damaging 1.00
X0027:Thsd7b UTSW 1 129,523,809 (GRCm39) missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129,556,648 (GRCm39) missense probably benign 0.17
Z1176:Thsd7b UTSW 1 129,523,397 (GRCm39) missense probably benign 0.01
Z1176:Thsd7b UTSW 1 129,523,253 (GRCm39) missense probably damaging 0.98
Z1176:Thsd7b UTSW 1 130,108,161 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATGCTTTGTGATCATGAGGGAATTC -3'
(R):5'- TGTTTCTATACCCACAGTCCAAAC -3'

Sequencing Primer
(F):5'- GAAGATACTGTGTATCCTGAGGG -3'
(R):5'- TACCCACAGTCCAAACACATTAAATC -3'
Posted On 2016-11-15