Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Dctn2'

444547

Institutional Source

Beutler Lab

Gene Symbol

Dctn2

Ensembl Gene

ENSMUSG00000025410

Gene Name

dynactin 2

Synonyms

RBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik

MMRRC Submission

042567-MU

Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127266368-127281950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127276703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 176 (R176C)

Ref Sequence

ENSEMBL: ENSMUSP00000026479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026479]

AlphaFold

Q99KJ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000026479
AA Change: R176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410
AA Change: R176C

Domain	Start	End	E-Value	Type
Pfam:Dynamitin	16	400	7.1e-129	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220418

Meta Mutation Damage Score

0.5685

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]

Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Dctn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Dctn2	APN	10	127277690	unclassified	probably benign
IGL01749:Dctn2	APN	10	127281417	missense	possibly damaging	0.47
IGL01797:Dctn2	APN	10	127277313	missense	possibly damaging	0.94
IGL02021:Dctn2	APN	10	127275057	critical splice donor site	probably null
IGL02335:Dctn2	APN	10	127275821	splice site	probably benign
IGL02748:Dctn2	APN	10	127277273	missense	probably damaging	1.00
IGL03382:Dctn2	APN	10	127278188	missense	probably damaging	0.99
R0069:Dctn2	UTSW	10	127277485	splice site	probably null
R0069:Dctn2	UTSW	10	127277485	splice site	probably null
R0621:Dctn2	UTSW	10	127277940	critical splice donor site	probably null
R1114:Dctn2	UTSW	10	127278142	splice site	probably null
R1917:Dctn2	UTSW	10	127275049	nonsense	probably null
R2238:Dctn2	UTSW	10	127276388	missense	probably damaging	0.97
R4097:Dctn2	UTSW	10	127277493	missense	probably damaging	1.00
R4418:Dctn2	UTSW	10	127278365	missense	probably benign	0.24
R6873:Dctn2	UTSW	10	127276236	splice site	probably null
R7533:Dctn2	UTSW	10	127267478	missense	possibly damaging	0.87
R7557:Dctn2	UTSW	10	127278404	missense	probably benign	0.44
R7657:Dctn2	UTSW	10	127266514	missense	probably damaging	1.00
R8218:Dctn2	UTSW	10	127276529	missense	probably damaging	0.97
R8557:Dctn2	UTSW	10	127278193	missense	probably damaging	1.00
R9344:Dctn2	UTSW	10	127278215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGCTAAGTGAGTGCCCTC -3'
(R):5'- AAAGCTTTCCCTCCTAGGCC -3'

Sequencing Primer
(F):5'- TGAGTGCCCTCAGCCGC -3'
(R):5'- CTGCAAAGGCCACTCGC -3'

Posted On

2016-11-15