Incidental Mutation 'R4972:Dctn2'
ID444547
Institutional Source Beutler Lab
Gene Symbol Dctn2
Ensembl Gene ENSMUSG00000025410
Gene Namedynactin 2
SynonymsRBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik
MMRRC Submission 042567-MU
Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127266368-127281950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127276703 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 176 (R176C)
Ref Sequence ENSEMBL: ENSMUSP00000026479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026479]
Predicted Effect probably damaging
Transcript: ENSMUST00000026479
AA Change: R176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410
AA Change: R176C

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220418
Meta Mutation Damage Score 0.5685 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Dctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dctn2 APN 10 127277690 unclassified probably benign
IGL01749:Dctn2 APN 10 127281417 missense possibly damaging 0.47
IGL01797:Dctn2 APN 10 127277313 missense possibly damaging 0.94
IGL02021:Dctn2 APN 10 127275057 critical splice donor site probably null
IGL02335:Dctn2 APN 10 127275821 splice site probably benign
IGL02748:Dctn2 APN 10 127277273 missense probably damaging 1.00
IGL03382:Dctn2 APN 10 127278188 missense probably damaging 0.99
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0621:Dctn2 UTSW 10 127277940 critical splice donor site probably null
R1114:Dctn2 UTSW 10 127278142 unclassified probably null
R1917:Dctn2 UTSW 10 127275049 nonsense probably null
R2238:Dctn2 UTSW 10 127276388 missense probably damaging 0.97
R4097:Dctn2 UTSW 10 127277493 missense probably damaging 1.00
R4418:Dctn2 UTSW 10 127278365 missense probably benign 0.24
R6873:Dctn2 UTSW 10 127276236 intron probably null
R7533:Dctn2 UTSW 10 127267478 missense possibly damaging 0.87
R7557:Dctn2 UTSW 10 127278404 missense probably benign 0.44
R7657:Dctn2 UTSW 10 127266514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCTAAGTGAGTGCCCTC -3'
(R):5'- AAAGCTTTCCCTCCTAGGCC -3'

Sequencing Primer
(F):5'- TGAGTGCCCTCAGCCGC -3'
(R):5'- CTGCAAAGGCCACTCGC -3'
Posted On2016-11-15