Mutagenetix > Incidental Mutation

Incidental Mutation 'R4956:5830411N06Rik'

444550

Institutional Source

Beutler Lab

Gene Symbol

5830411N06Rik

Ensembl Gene

ENSMUSG00000054672

Gene Name

RIKEN cDNA 5830411N06 gene

Synonyms

Scart2

MMRRC Submission

042553-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4956 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140247284-140300736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140298362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1001 (I1001V)

Ref Sequence

ENSEMBL: ENSMUSP00000131905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]

AlphaFold

B3F5L4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059882

SMART Domains

Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093984
AA Change: I885V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: I885V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART
SR	446	546	8.78e-30	SMART
SR	551	651	1.26e-53	SMART
SR	656	756	2.88e-16	SMART
SR	783	883	7.62e-48	SMART
transmembrane domain	903	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164583
AA Change: I1001V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: I1001V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
Blast:SR	291	349	5e-12	BLAST
SR	354	452	1.65e-34	SMART
SR	456	556	4.53e-32	SMART
SR	562	662	8.78e-30	SMART
SR	667	767	1.26e-53	SMART
SR	772	872	2.88e-16	SMART
SR	899	999	7.62e-48	SMART
transmembrane domain	1019	1041	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210212

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211749

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

96% (70/73)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	C	1: 120,169,110		probably benign	Het
3110009E18Rik	G	T	1: 120,169,119		probably benign	Het
3110009E18Rik	C	T	1: 120,169,120		probably benign	Het
4930562C15Rik	A	G	16: 4,854,952	K866E	probably damaging	Het
Afap1l2	T	C	19: 56,943,447	M49V	probably benign	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Atp2a2	A	G	5: 122,461,580	F583L	probably benign	Het
Atxn7l3b	A	G	10: 112,928,596	C43R	probably damaging	Het
Axin2	T	C	11: 108,943,078	V617A	probably damaging	Het
Brd1	A	T	15: 88,730,113	F193Y	probably damaging	Het
Cdc27	T	C	11: 104,529,395	S141G	probably damaging	Het
Chst9	A	T	18: 15,717,988	F7Y	probably damaging	Het
Cpn2	T	A	16: 30,260,415	Q156L	possibly damaging	Het
Dcaf6	A	T	1: 165,388,785	D416E	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Eif2s3y	A	G	Y: 1,023,407	T430A	possibly damaging	Het
Enah	G	A	1: 181,918,289	T401I	probably damaging	Het
Esp38	T	G	17: 39,955,162	I54R	probably damaging	Het
Ffar4	C	T	19: 38,097,580	R152W	probably benign	Het
Fzd9	G	A	5: 135,249,942	A363V	probably damaging	Het
Gadl1	T	A	9: 116,040,919	I451N	probably benign	Het
Hmg20a	A	G	9: 56,481,664	T172A	probably damaging	Het
Ints1	G	A	5: 139,757,130	T1695M	probably damaging	Het
Ipo13	G	A	4: 117,901,571	A699V	probably benign	Het
Ipo9	A	G	1: 135,404,222		probably null	Het
Klra17	A	G	6: 129,873,316	L57P	probably damaging	Het
Map3k8	A	C	18: 4,339,530	D280E	probably benign	Het
Mfsd7b	A	G	1: 191,026,186		probably benign	Het
Mycbp2	A	G	14: 103,287,239	F662L	probably damaging	Het
Ncor1	T	A	11: 62,340,605	H792L	probably damaging	Het
Nlrx1	T	A	9: 44,262,612	K431*	probably null	Het
Nos1	A	G	5: 117,947,510	N1301S	probably benign	Het
Obp2b	A	G	2: 25,737,075	T7A	probably damaging	Het
Odc1	T	C	12: 17,547,957	I95T	probably damaging	Het
Olfr1262	G	A	2: 90,002,843	V146M	probably benign	Het
Olfr1447	C	T	19: 12,901,599	M60I	probably damaging	Het
Olfr224	A	G	11: 58,566,518	Y276H	probably damaging	Het
Olfr522	A	G	7: 140,162,080	I290T	possibly damaging	Het
Olfr802	A	T	10: 129,682,099	F213L	probably benign	Het
Pcif1	A	T	2: 164,889,690	Q521L	probably damaging	Het
Plekhg2	A	C	7: 28,368,355	L223R	probably damaging	Het
Plod3	A	G	5: 136,989,918	N270D	probably damaging	Het
Ppp1r37	A	T	7: 19,532,711	L417*	probably null	Het
Psmd6	C	T	14: 14,116,166	V141I	probably benign	Het
Rcn1	A	T	2: 105,394,776	Y111*	probably null	Het
Rell2	G	A	18: 37,957,705	R145H	probably damaging	Het
Scaper	T	C	9: 55,838,142	K614R	probably damaging	Het
Shbg	C	T	11: 69,617,219	E107K	probably damaging	Het
Slc30a3	G	A	5: 31,086,903	P345L	possibly damaging	Het
Tchp	A	C	5: 114,719,620	E391D	probably damaging	Het
Timeless	A	G	10: 128,241,651	D200G	probably damaging	Het
Tspear	A	G	10: 77,864,767	T144A	possibly damaging	Het
Uhrf1bp1	T	A	17: 27,889,984		probably null	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vgll3	T	C	16: 65,827,934	V56A	possibly damaging	Het
Vmn2r71	C	T	7: 85,619,228	T213I	probably benign	Het
Wtap	T	C	17: 12,967,536	T375A	probably benign	Het
Yipf2	T	G	9: 21,591,908	T88P	probably damaging	Het
Zfp382	T	A	7: 30,131,554	D89E	probably benign	Het
Zfp955b	C	T	17: 33,305,235		probably benign	Het
Zpr1	C	T	9: 46,274,663	T144I	probably damaging	Het

Other mutations in 5830411N06Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:5830411N06Rik	APN	7	140294842	missense	probably damaging	0.99
IGL01101:5830411N06Rik	APN	7	140296104	missense	probably benign	0.35
IGL01120:5830411N06Rik	APN	7	140296559	missense	probably benign	0.02
IGL01958:5830411N06Rik	APN	7	140274127	missense	probably damaging	1.00
IGL02150:5830411N06Rik	APN	7	140297859	missense	possibly damaging	0.84
IGL02193:5830411N06Rik	APN	7	140249000	missense	probably benign	0.17
IGL02239:5830411N06Rik	APN	7	140295843	missense	probably damaging	1.00
IGL02335:5830411N06Rik	APN	7	140296540	missense	probably damaging	1.00
IGL02569:5830411N06Rik	APN	7	140298362	missense	probably benign	0.01
IGL02993:5830411N06Rik	APN	7	140296573	missense	probably benign	0.07
IGL03261:5830411N06Rik	APN	7	140294833	missense	probably benign	0.00
IGL03365:5830411N06Rik	APN	7	140296769	missense	probably damaging	1.00
IGL03399:5830411N06Rik	APN	7	140247956	missense	probably benign	0.00
IGL03052:5830411N06Rik	UTSW	7	140248914	missense	probably damaging	1.00
PIT4791001:5830411N06Rik	UTSW	7	140274062	missense	possibly damaging	0.53
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0347:5830411N06Rik	UTSW	7	140297854	missense	probably damaging	1.00
R0374:5830411N06Rik	UTSW	7	140248961	missense	probably damaging	1.00
R0639:5830411N06Rik	UTSW	7	140247959	missense	probably benign	0.01
R0667:5830411N06Rik	UTSW	7	140261537	missense	possibly damaging	0.73
R0789:5830411N06Rik	UTSW	7	140248220	missense	probably damaging	1.00
R0959:5830411N06Rik	UTSW	7	140294791	missense	probably damaging	1.00
R1316:5830411N06Rik	UTSW	7	140299670	missense	probably benign	0.09
R1764:5830411N06Rik	UTSW	7	140297265	missense	probably benign	0.00
R2247:5830411N06Rik	UTSW	7	140249129	missense	probably null	0.96
R2379:5830411N06Rik	UTSW	7	140299769	missense	probably benign	0.15
R4112:5830411N06Rik	UTSW	7	140298368	nonsense	probably null
R4114:5830411N06Rik	UTSW	7	140297910	missense	probably damaging	1.00
R4346:5830411N06Rik	UTSW	7	140247965	missense	probably damaging	0.97
R4836:5830411N06Rik	UTSW	7	140299108	missense	probably benign
R5208:5830411N06Rik	UTSW	7	140298036	missense	probably benign	0.00
R5571:5830411N06Rik	UTSW	7	140249123	missense	probably damaging	1.00
R5583:5830411N06Rik	UTSW	7	140296826	missense	probably damaging	1.00
R5645:5830411N06Rik	UTSW	7	140248940	missense	possibly damaging	0.95
R6183:5830411N06Rik	UTSW	7	140296034	missense	possibly damaging	0.82
R6995:5830411N06Rik	UTSW	7	140261601	missense	probably benign
R7436:5830411N06Rik	UTSW	7	140261607	missense	probably benign
R7621:5830411N06Rik	UTSW	7	140296829	missense	probably damaging	1.00
R7662:5830411N06Rik	UTSW	7	140294812	missense	possibly damaging	0.58
R7669:5830411N06Rik	UTSW	7	140296321	missense	possibly damaging	0.47
R7686:5830411N06Rik	UTSW	7	140249052	missense	probably benign	0.00
R7985:5830411N06Rik	UTSW	7	140296893	missense	probably damaging	1.00
R8330:5830411N06Rik	UTSW	7	140296318	nonsense	probably null
R8843:5830411N06Rik	UTSW	7	140249000	missense	possibly damaging	0.93
R8888:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R8895:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R9044:5830411N06Rik	UTSW	7	140248097	missense	probably damaging	1.00
R9142:5830411N06Rik	UTSW	7	140297893	missense	probably damaging	1.00
R9152:5830411N06Rik	UTSW	7	140297343	missense	possibly damaging	0.55
R9470:5830411N06Rik	UTSW	7	140247432	missense	probably benign	0.07
R9509:5830411N06Rik	UTSW	7	140299731	nonsense	probably null
R9522:5830411N06Rik	UTSW	7	140274074	missense	possibly damaging	0.73
R9755:5830411N06Rik	UTSW	7	140261631	critical splice donor site	probably null
R9794:5830411N06Rik	UTSW	7	140294803	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAGCACAGGACTCCAGTG -3'
(R):5'- GCTCATGACCGGGTAGTTTG -3'

Sequencing Primer
(F):5'- AGCACAGGACTCCAGTGTTCAG -3'
(R):5'- GTTTTCCCATTCAGCAGGCACAG -3'

Posted On

2016-11-16