Incidental Mutation 'R4967:Fgg'
ID 444557
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Name fibrinogen gamma chain
Synonyms 3010002H13Rik, gamma-fibrinogen
MMRRC Submission 042563-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.748) question?
Stock # R4967 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 82915031-82922356 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82920072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 284 (T284S)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
AlphaFold Q8VCM7
Predicted Effect probably benign
Transcript: ENSMUST00000048486
AA Change: T284S

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: T284S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193581
Predicted Effect probably benign
Transcript: ENSMUST00000194175
AA Change: T284S

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: T284S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Meta Mutation Damage Score 0.0978 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,956,502 (GRCm39) Y199* probably null Het
Adhfe1 A T 1: 9,637,029 (GRCm39) I394F probably benign Het
Arhgap26 G T 18: 39,379,893 (GRCm39) R485L probably damaging Het
Atat1 T A 17: 36,212,467 (GRCm39) N231I probably damaging Het
B4galnt2 T C 11: 95,760,100 (GRCm39) N309S probably benign Het
Bank1 A T 3: 135,772,134 (GRCm39) F499I probably damaging Het
Bcl9l A G 9: 44,416,365 (GRCm39) D146G possibly damaging Het
Bglap3 A T 3: 88,283,671 (GRCm39) probably benign Het
Bscl2 C A 19: 8,825,344 (GRCm39) T376K probably benign Het
Cercam A T 2: 29,761,033 (GRCm39) probably null Het
Clec4f C T 6: 83,633,012 (GRCm39) M1I probably null Het
Clec4n A T 6: 123,209,066 (GRCm39) I14F probably benign Het
Cmya5 T C 13: 93,227,093 (GRCm39) E2665G probably damaging Het
Cog4 T A 8: 111,578,915 (GRCm39) probably null Het
Cubn A G 2: 13,352,856 (GRCm39) F1961L probably benign Het
Cyp4a29 A T 4: 115,104,196 (GRCm39) H88L probably benign Het
Dhdh A G 7: 45,128,530 (GRCm39) L216P probably damaging Het
Dpp6 T C 5: 27,871,509 (GRCm39) F544S probably damaging Het
Dthd1 C T 5: 63,045,549 (GRCm39) T771I probably benign Het
Emc10 A G 7: 44,142,612 (GRCm39) probably null Het
Gask1a C T 9: 121,794,784 (GRCm39) R313W probably damaging Het
Gm3002 T A 14: 3,824,737 (GRCm38) N24K probably damaging Het
Gm8674 G A 13: 50,056,034 (GRCm39) noncoding transcript Het
Gpr63 G A 4: 25,008,368 (GRCm39) W364* probably null Het
Hcn4 C G 9: 58,767,111 (GRCm39) P891A unknown Het
Hcrtr1 A T 4: 130,024,792 (GRCm39) F365I possibly damaging Het
Hmcn2 A G 2: 31,244,176 (GRCm39) probably null Het
Hoxc5 T A 15: 102,923,786 (GRCm39) L194H probably damaging Het
Ifna11 A G 4: 88,738,287 (GRCm39) N31S probably null Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Iqgap2 A T 13: 95,766,514 (GRCm39) D1496E probably benign Het
Kif28 G T 1: 179,536,007 (GRCm39) Q556K probably damaging Het
Klhl42 C T 6: 147,009,502 (GRCm39) T447I possibly damaging Het
Lrp1b A C 2: 41,678,986 (GRCm39) D35E probably damaging Het
Lsm14b A G 2: 179,675,692 (GRCm39) probably benign Het
Map3k1 T C 13: 111,909,272 (GRCm39) E226G probably damaging Het
Map3k14 T A 11: 103,130,357 (GRCm39) N187Y probably benign Het
Mcm6 A T 1: 128,263,586 (GRCm39) V645E probably damaging Het
Mdh1b G T 1: 63,759,022 (GRCm39) P190Q probably damaging Het
Meiob T G 17: 25,037,353 (GRCm39) L77R probably damaging Het
Mrgpra3 A T 7: 47,239,267 (GRCm39) F220I probably benign Het
Mrtfa C A 15: 80,929,476 (GRCm39) probably benign Het
Mtor T A 4: 148,575,817 (GRCm39) S1324T possibly damaging Het
Myot T A 18: 44,487,995 (GRCm39) D437E possibly damaging Het
Ncoa6 G T 2: 155,263,252 (GRCm39) T394K possibly damaging Het
Nf1 T A 11: 79,456,379 (GRCm39) probably null Het
Nup210 T A 6: 91,013,451 (GRCm39) T1190S possibly damaging Het
Odf1 T A 15: 38,226,652 (GRCm39) I184N probably damaging Het
Or10d1 C T 9: 39,484,054 (GRCm39) C167Y probably damaging Het
Or13d1 T C 4: 52,970,960 (GRCm39) V113A possibly damaging Het
Or1n1b A G 2: 36,780,719 (GRCm39) I47T probably damaging Het
Or5k15 G T 16: 58,709,957 (GRCm39) Q209K possibly damaging Het
Padi1 A G 4: 140,572,901 (GRCm39) V21A probably benign Het
Pdzrn3 C T 6: 101,128,551 (GRCm39) R705H probably damaging Het
Pik3cb T C 9: 98,987,685 (GRCm39) I18V probably benign Het
Pmpca T C 2: 26,280,320 (GRCm39) S117P probably damaging Het
Poteg T A 8: 27,985,009 (GRCm39) probably benign Het
Pramel32 T C 4: 88,547,432 (GRCm39) T80A probably damaging Het
Rab30 G A 7: 92,478,771 (GRCm39) R72H probably damaging Het
Ramp2 T A 11: 101,138,383 (GRCm39) probably null Het
Rbks G A 5: 31,781,876 (GRCm39) T308I probably damaging Het
Rnf112 A G 11: 61,343,752 (GRCm39) probably benign Het
Rnf38 G A 4: 44,152,460 (GRCm39) P3S probably damaging Het
Sec16a A G 2: 26,302,883 (GRCm39) S2344P probably benign Het
Slc16a8 C T 15: 79,137,084 (GRCm39) V109M possibly damaging Het
Slc28a1 A T 7: 80,791,757 (GRCm39) T308S possibly damaging Het
Slc39a3 T C 10: 80,867,453 (GRCm39) T98A possibly damaging Het
Smarcc2 T C 10: 128,319,049 (GRCm39) F731L probably damaging Het
Smc4 A G 3: 68,925,572 (GRCm39) probably benign Het
Sparcl1 T G 5: 104,240,776 (GRCm39) D216A probably damaging Het
Speg G A 1: 75,364,513 (GRCm39) R192H probably damaging Het
Sspo T C 6: 48,441,539 (GRCm39) L1892P probably damaging Het
Styxl2 A T 1: 165,954,675 (GRCm39) V25E probably damaging Het
Tacc2 A G 7: 130,225,678 (GRCm39) N807D probably damaging Het
Teddm1a A T 1: 153,767,979 (GRCm39) K148* probably null Het
Tex15 T A 8: 34,064,498 (GRCm39) D1309E probably benign Het
Thbs1 A T 2: 117,945,259 (GRCm39) E277D probably benign Het
Ticrr G A 7: 79,310,158 (GRCm39) R24Q probably damaging Het
Tigd4 A G 3: 84,502,460 (GRCm39) E459G probably benign Het
Tln2 C A 9: 67,262,407 (GRCm39) A615S probably damaging Het
Tmprss5 T C 9: 49,026,817 (GRCm39) V410A probably damaging Het
Tnrc6a G T 7: 122,789,095 (GRCm39) W1638L probably damaging Het
Tpr A G 1: 150,285,810 (GRCm39) D424G probably damaging Het
Trim34a A T 7: 103,910,271 (GRCm39) K358* probably null Het
Tssk5 T A 15: 76,258,856 (GRCm39) D10V possibly damaging Het
Usp35 A C 7: 96,962,782 (GRCm39) L470R probably damaging Het
Usp42 T C 5: 143,701,119 (GRCm39) D968G possibly damaging Het
Utrn A G 10: 12,331,164 (GRCm39) V2924A probably damaging Het
Wdtc1 C A 4: 133,021,654 (GRCm39) A627S probably damaging Het
Xrra1 A G 7: 99,555,730 (GRCm39) T366A probably damaging Het
Zfp712 T A 13: 67,188,773 (GRCm39) K585* probably null Het
Zfp97 T A 17: 17,365,393 (GRCm39) N297K probably damaging Het
Zfp97 G T 17: 17,364,938 (GRCm39) E146* probably null Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 82,921,535 (GRCm39) missense possibly damaging 0.67
IGL01713:Fgg APN 3 82,915,723 (GRCm39) missense probably benign 0.20
IGL02288:Fgg APN 3 82,915,460 (GRCm39) missense probably benign 0.11
IGL02994:Fgg APN 3 82,915,781 (GRCm39) missense probably benign
PIT4519001:Fgg UTSW 3 82,920,246 (GRCm39) missense probably damaging 1.00
R1251:Fgg UTSW 3 82,920,287 (GRCm39) missense probably benign 0.03
R2137:Fgg UTSW 3 82,915,745 (GRCm39) missense possibly damaging 0.78
R2400:Fgg UTSW 3 82,915,494 (GRCm39) missense possibly damaging 0.94
R2436:Fgg UTSW 3 82,921,496 (GRCm39) missense possibly damaging 0.94
R3429:Fgg UTSW 3 82,920,090 (GRCm39) missense probably damaging 1.00
R4356:Fgg UTSW 3 82,920,250 (GRCm39) missense probably damaging 1.00
R4612:Fgg UTSW 3 82,917,397 (GRCm39) missense probably damaging 1.00
R4613:Fgg UTSW 3 82,917,397 (GRCm39) missense probably damaging 1.00
R4828:Fgg UTSW 3 82,915,677 (GRCm39) splice site probably benign
R4898:Fgg UTSW 3 82,915,847 (GRCm39) missense probably benign 0.02
R4938:Fgg UTSW 3 82,920,175 (GRCm39) missense probably benign 0.00
R5635:Fgg UTSW 3 82,918,730 (GRCm39) missense probably benign 0.07
R5740:Fgg UTSW 3 82,918,832 (GRCm39) missense probably benign 0.01
R6307:Fgg UTSW 3 82,920,283 (GRCm39) missense probably damaging 0.98
R6731:Fgg UTSW 3 82,920,208 (GRCm39) missense probably damaging 1.00
R6936:Fgg UTSW 3 82,915,727 (GRCm39) missense possibly damaging 0.82
R7582:Fgg UTSW 3 82,921,445 (GRCm39) missense probably damaging 1.00
R7769:Fgg UTSW 3 82,920,433 (GRCm39) splice site probably null
R8258:Fgg UTSW 3 82,917,477 (GRCm39) nonsense probably null
R8259:Fgg UTSW 3 82,917,477 (GRCm39) nonsense probably null
R8290:Fgg UTSW 3 82,920,141 (GRCm39) missense probably benign 0.00
R8810:Fgg UTSW 3 82,920,322 (GRCm39) missense probably damaging 0.96
R8826:Fgg UTSW 3 82,921,625 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATAAGTTTCCATTTGGTCTCAAG -3'
(R):5'- ATCGTTGTCGTTGTCCCAGG -3'

Sequencing Primer
(F):5'- CCATTTGGTCTCAAGATTCTGAAAC -3'
(R):5'- AGGTACTGAACTGCATGCC -3'
Posted On 2016-11-16