Incidental Mutation 'R5737:Vmn2r26'
ID444579
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
MMRRC Submission 043195-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124039449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 291 (V291F)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: V291F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: V291F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,559,242 V78A probably damaging Het
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Ccer1 A T 10: 97,694,684 H403L possibly damaging Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Slc6a3 A C 13: 73,544,804 N181T probably damaging Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tdrd5 A G 1: 156,300,724 M136T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Tomt T C 7: 101,900,317 T255A probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R7914:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTAGGGACATTACCAAGGAGATGATC -3'
(R):5'- AAGCTTGACCATACATGCCG -3'

Sequencing Primer
(F):5'- CATTACCAAGGAGATGATCAGCCATG -3'
(R):5'- GCTTGACCATACATGCCGGATAAAG -3'
Posted On2016-11-21